A Short Bout Of Exercise Enhances Brain Function – Chatzi C, Zhang Y, Hendricks WD, Chen Y, Schnell E, Goodman RH, Westbrook GL. Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L. Elife. 2019 Jun 24;8. pii: e45920. doi: 10.7554/eLife.45920. @ New rapid test diagnoses pneumonia and lower respiratory infections

A Short Bout Of Exercise Enhances Brain Function

Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L. Elife. 2019 Jun 24;8. pii: e45920. doi: 10.7554/eLife.45920.

westbroo@ohsu.edu goodmanr@ohsu.edu

  1. Christina Chatzi
  2. Yingyu Zhang
  3. Wiiliam D Hendricks
  4. Yang Chen
  5. Eric Schnell
  6. Richard H Goodman
  7. Gary L Westbrook 
  1. Oregon Health & Science University, United States; 
  2. Portland VA Health Care System, United States

https://www.ncbi.nlm.nih.gov/pubmed/31232686

https://elifesciences.org/articles/45920

https://www.sciencedaily.com/releases/2019/07/190702184555.htm

Short bout of exercise enhances brain function

https://www.researchgate.net/publication/333986787_Exercise-induced_enhancement_of_synaptic_function_triggered_by_the_inverse_BAR_protein_Mtss1L

Click to access 545582.full.pdf

https://www.readcube.com/articles/10.7554/eLife.45920

http://www.pubniche.com/papyrus/ZG9pOjoxMC43NTU0L2VMaWZlLjQ1OTIw/

Brief Periods of Exercise Enhance Brain Function, Animal Study Shows

sci-news.com – In a study done in mice, a team of researchers found that short-term bursts of exercise promoted an increase in synapses in the hippocampus and prime the brain for learning.

Source: Christina Chatzi, et al. Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L. eLife,2019.

More: sciencedaily.com  scienceblog.com  eurekalert.org  sci-news.com 

HomeFeatured

Short bout of exercise enhances brain function

NEUROSCIENCE NEWSJULY 2, 2019FEATUREDNEUROSCIENCEOPEN NEUROSCIENCE ARTICLES5 MIN READ

Summary: Short bursts of exercise, equivalent to a pick-up game of basketball, boosts the function of a gene that increases dendritic spines in the hippocampus, helping to improve memory and learning.

Source: Orgeon Health and Science University

Most people know that regular exercise is good for your health. New research shows it may make you smarter, too.

Neuroscientists at OHSU in Portland, Oregon, working with mice, have discovered that a short burst of exercise directly boosts the function of a gene that increases connections between neurons in the hippocampus, the region of the brain associated with learning and memory.

The research is published online in the journal eLife.

“Exercise is cheap, and you don’t necessarily need a fancy gym membership or have to run 10 miles a day,” said co-senior author Gary Westbrook, M.D., senior scientist at the OHSU Vollum Institute and Dixon Professor of Neurology in the OHSU School of Medicine.

Previous research in animals and in people shows that regular exercise promotes general brain health. However, it’s hard to untangle the overall benefits of exercise to the heart, liver, and muscles from the specific effect on the brain. For example, a healthy heart oxygenates the whole body, including the brain.

“Previous studies of exercise almost all focus on sustained exercise,” Westbrook said. “As neuroscientists, it’s not that we don’t care about the benefits on the heart and muscles but we wanted to know the brain-specific benefit of exercise.”

So the scientists designed a study in mice that specifically measured the brain’s response to single bouts of exercise in otherwise sedentary mice that were placed for short periods on running wheels. The mice ran a few kilometers in two hours.

The study found that short-term bursts of exercise – the human equivalent of a weekly game of pickup basketball, or 4,000 steps – promoted an increase in synapses in the hippocampus. Scientists made the key discovery by analyzing genes that were increased in single neurons activated during exercise.

One particular gene stood out: Mtss1L. This gene had been largely ignored in prior studies in the brain.

“That was the most exciting thing,” said co-lead author Christina Chatzi, Ph.D.

This shows a man about to run

The study found that short-term bursts of exercise – the human equivalent of a weekly game of pickup basketball, or 4,000 steps – promoted an increase in synapses in the hippocampus. Scientists made the key discovery by analyzing genes that were increased in single neurons activated during exercise. The image is in the public domain.

The Mtss1L gene encodes a protein that causes bending of the cell membrane. Researchers discovered that when this gene is activated by short bursts of exercise, it promotes small growths on neurons known as dendritic spines – the site at which synapses form.

In effect, the study showed that an acute burst of exercise is enough to prime the brain for learning.

In the next stage of research, scientists plan to pair acute bouts of exercise with learning tasks to better understand the impact on learning and memory.

Funding: This research was supported by National Institute of Neurological Disorders and Stroke of the National Institutes of Health under grant numbers R01NS080979 (RG,GW), F31NS098597 (WH); Department of Veterans Affairs Merit Review award I01-BX002949 and the Assistant Secretary of Defense for Health Affairs endorsed by the Department of Defense through the Congressionally Directed Medical Research Program under award number W81XWH-18-1-0598 (ES); and a Ronni Lacroute fellowship (CC). The content, including opinions, interpretations, conclusions and recommendations are those of the authors and are not necessarily endorsed by the National Institutes of Health, U.S. Department of Veterans Affairs, Department of Defense or the United States government.

In addition to Westbrook and Chatzi, other authors included co-lead author Gina Zhang, PhD., researcher in the Goodman lab; co-senior author Richard Goodman, M.D., Ph.D., senior scientist in the Vollum Institute, William Hendricks, Ph.D., postdoctoral researcher in the Schnell lab at OHSU; Yang Chen, graduate student in the Mao lab at OHSU; and Eric Schnell, M.D., Ph.D., associate professor of anesthesiology and perioperative medicine in the OHSU School of Medicine.ABOUT THIS NEUROSCIENCE RESEARCH ARTICLE

Source:
Orgeon Health and Science University
Media Contacts: 
Erik Robinson – Orgeon Health and Science University
Image Source:
The image is in the public domain.

Original Research: Open access
“Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L”.Christina Chatzi, Gina Zhang, Wiiliam D Hendricks, Yang Chen, Eric Schnell, Richard H Goodman, Gary L Westbrook.
eLife. doi:10.7554/eLife.45920

Abstract

Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L

Exercise is a potent enhancer of learning and memory, yet we know little of the underlying mechanisms that likely include alterations in synaptic efficacy in the hippocampus. To address this issue, we exposed mice to a single episode of voluntary exercise, and permanently marked activated mature hippocampal dentate granule cells using conditional Fos-TRAP mice. Exercise-activated neurons (Fos-TRAPed) showed an input-selective increase in dendritic spines and excitatory postsynaptic currents at 3 days post-exercise, indicative of exercise-induced structural plasticity. Laser-capture microdissection and RNASeq of activated neurons revealed that the most highly induced transcript was Mtss1L, a little-studied I-BAR domain-containing gene, which we hypothesized could be involved in membrane curvature and dendritic spine formation. shRNA-mediated Mtss1L knockdown in vivo prevented the exercise-induced increases in spines and excitatory postsynaptic currents. Our results link short-term effects of exercise to activity-dependent expression of Mtss1L, which we propose as a novel effector of activity-dependent rearrangement of synapses.

  1. NEUROSCIENCE

A two-part list of links to download the article, or parts of the article, in various formats.

DOWNLOADS(LINK TO DOWNLOAD THE ARTICLE AS PDF)

DOWNLOAD CITATIONS(LINKS TO DOWNLOAD THE CITATIONS FROM THIS ARTICLE IN FORMATS COMPATIBLE WITH VARIOUS REFERENCE MANAGER TOOLS)

OPEN CITATIONS(LINKS TO OPEN THE CITATIONS FROM THIS ARTICLE IN VARIOUS ONLINE REFERENCE MANAGER SERVICES)

Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L

  1. Christina Chatzi
  2. Yingyu Zhang
  3. Wiiliam D Hendricks
  4. Yang Chen
  5. Eric Schnell
  6. Richard H Goodman
  7. Gary L Westbrook 
  1. Oregon Health & Science University, United States; 
  2. Portland VA Health Care System, United States

RESEARCH ARTICLE Jun 24, 2019

  • CITED 0
  • VIEWS 3,506
  • ANNOTATIONS 0Open annotations. The current annotation count on this page is 0.

CITE THIS ARTICLEAS: eLife 2019;8:e45920 DOI: 10.7554/eLife.45920

Abstract

Exercise is a potent enhancer of learning and memory, yet we know little of the underlying mechanisms that likely include alterations in synaptic efficacy in the hippocampus. To address this issue, we exposed mice to a single episode of voluntary exercise, and permanently marked activated mature hippocampal dentate granule cells using conditional Fos-TRAP mice. Exercise-activated neurons (Fos-TRAPed) showed an input-selective increase in dendritic spines and excitatory postsynaptic currents at 3 days post-exercise, indicative of exercise-induced structural plasticity. Laser-capture microdissection and RNASeq of activated neurons revealed that the most highly induced transcript was Mtss1L, a little-studied I-BAR domain-containing gene, which we hypothesized could be involved in membrane curvature and dendritic spine formation. shRNA-mediated Mtss1Lknockdown in vivo prevented the exercise-induced increases in spines and excitatory postsynaptic currents. Our results link short-term effects of exercise to activity-dependent expression of Mtss1L, which we propose as a novel effector of activity-dependent rearrangement of synapses.https://doi.org/10.7554/eLife.45920.001“Open annotations. The current annotation count on this page is 0.Introduction

The beneficial cognitive effects of physical exercise cross the lifespan as well as disease boundaries (Mandolesi et al., 2018Saraulli et al., 2017). Exercise alters neural activity in local hippocampal circuits, presumably by enhancing learning and memory through short- and long-term changes in synaptic plasticity (Vivar et al., 2013Voss et al., 2013). The dentate gyrus is uniquely important in learning and memory, acting as an input stage for encoding contextual and spatial information from multiple brain regions. This circuit is well suited to its biological function because of its sparse coding design, with only a few dentate granule cells active at any one time (Jung and McNaughton, 1993Leutgeb et al., 2007Severa et al., 2017). These properties also provide an ideal network to investigate how exercise-induced changes in activity-dependent gene expression affect hippocampal structural and synaptic plasticity in vivo.

Most studies have focused on the cognitive effects of sustained exercise (Bolz et al., 2015Creer et al., 2010Uda et al., 2006). However, memory improvements are well documented after acute bouts of exercise (Mandolesi et al., 2018Perini et al., 2016). Thus, the response to a single episode of exercise may be better suited to uncover cellular and molecular cascades that form and rearrange synapses, and which evolve over minutes to weeks following exercise. We reasoned that these mechanisms could be unmasked by a single period of voluntary exercise in vivo, followed by functional and molecular analysis of subsequent changes specific to neurons that were activated during the exercise.Results

cFoscreERT2 transgenic mice (Fos-TRAP) provide valid proxies of neural activity (12and Figure 1—figure supplement 1) and a means to permanently label activated dentate granule cells. During a two-hour exposure to running wheels, mice ran approximately 3 km. We examined activated cells 3 days post-running in Fos-TRAP mice crossed with a TdT reporter line (Figure 1A). We used Fos immunohistochemistry at 1 hr post-exercise, confirming robust stimulation of neuronal activity in mature granule cells (Figure 1B). The increase in Fos expression, assessed by immunohistochemistry, matched the increase in TdTomato-positive cells (TdT+) measured 3 or 7 day later in Fos-TRAP mice, indicating that activated granule cells were accurately and permanently labeled during the 2 hr time window Figure 1C). We refer to these cells as ‘exercise-TRAPed’. To investigate whether a single bout of exercise activated a specific subset of granule cells, we exercise TRAPed dentate granule cells (TdT+) and compared this population to an ensemble activated by a subsequent re-exposure to exercise either 1 or 4 days later, as measured by Fos immunohistochemistry at 2 hr after the 2nd exercise period (Figure 1D). When the two exercise periods were separated by 24 hr, only 13% of exercise TRAPed cells were activated in the 2nd exercise period. There was almost no overlap between the two neuronal ensembles (1%) when the two periods were separated by 4 days (Figure 1D, right panel). Exercise-TRAPed neurons were distributed through the granule cell body layer, without labeling in the subgranular zone. This indicates that our exercise protocol activated stochastic, non-overlapping sets of mature granule cells, consistent with the sparse coding design of this circuit.Figure 1 with 1 supplementDownload assetOpen asset

Single exposure to running wheel induces transient synaptic plasticity in exercise-TRAPed dentate granule cells.(A) Schematic showing exercise paradigm. Fos-TRAP:TdTomato (Guenthner et al., 2013) mice were injected with tamoxifen (150 mg/kg) 24 hr before exposure to 2 hr of voluntary exercise, while … see morehttps://doi.org/10.7554/eLife.45920.002

Figure 1—figure supplement 1Download assetOpen asset

In vitro validation of Fos-TRAP method.To validate the sensitivity of the Fos-TRAP method, primary hippocampal cultures were derived from 2-day-old Fos-TRAP pups (Guenthner et al., 2013), transduced with an AAV-flex-H2B-mRFP virus, and … see morehttps://doi.org/10.7554/eLife.45920.003

Higher cortical information converges on the dentate gyrus through laminated perforant path axons from the entorhinal cortex. To examine whether a single exposure to exercise altered structural plasticity in exercise-activated neurons, we analyzed exercise-TRAPed cells in mice 3 or 7 days post-exercise as compared to homecage controls (Figure 2A, left panels). Exercise-TRAPed cells showed a nearly 50% increase in dendritic spines at 3 days. This increase was limited to the outer molecular layer (OML), which interestingly, receives contextual and time information via the lateral perforant path (Hargreaves et al., 2005Yoganarasimha et al., 2011), whereas there was no change in dendritic spines in the middle molecular layer (MML), which receives spatial information via the medial perforant path (Hafting et al., 2005Sargolini et al., 2006). Consistent with a transient response to a single stimulus, spine density in the OML returned to baseline levels by 7 days (Figure 2A, right panels). Exercise did not affect total dendritic length in OML or MML indicating that the increase in spine density reflected an increase in the number of synapses (Figure 2—figure supplement 1).Figure 2 with 2 supplementsDownload assetOpen asset

A single bout of exercise induces a laminar-specific increase in excitatory synaptic innervation.(A) Representative images of TRAPed granule cell dendrites in the OML and MML from mice at baseline (i.e. homecage) or 3 days post-exercise. Scale bar: 5 µm. Spine densities were significantly … see morehttps://doi.org/10.7554/eLife.45920.004

Figure 2—figure supplement 2Download assetOpen asset

Paired-pulse ratio (PPR) in control and exercise-TRAPed granule cell paired recordings.(A) Representative EPSCs from paired-pulse experiments during 50 ms interstimulus interval (ISI) OML stimulation. Responses are scaled on the y-axis relative to the first peak (PPR, 50 ms ISI: tdT-, … see morehttps://doi.org/10.7554/eLife.45920.006

Figure 2—figure supplement 1Download assetOpen asset

Dendritic lengths were equal in outer and middle molecular layers of exercise TRAPed cells.(A) Representative image of dendrites of the outer molecular layer (light green) and middle molecular layer (light purple) of exercise-TRAPed cells (red) 3 days post-exercise. The band of VGluT2 … see morehttps://doi.org/10.7554/eLife.45920.005

The increase in spine density in the OML was associated with a corresponding increase in functional synaptic input in exercise-TRAPed cells (Figure 2B). Three days after exercise, we used acute brain slices to make simultaneous whole-cell voltage clamp recordings from an exercise-TRAPed granule cell (yellow, Figure 2B, middle) and a neighboring control granule cell (green, Figure 2B, middle). Selective stimulation of lateral perforant path (LPP) axons evoked nearly three-fold larger EPSCs in the exercise-TRAPed cell of the simultaneously recorded cell pair (Figure 2C,D), whereas EPSC amplitudes evoked by stimulation of medial perforant path axons (MPP) were unaffected (Figure 2C,D). Plotting each cell pair as a function of the site of stimulation indicated that MPP cell pairs were on the unity line, whereas LPP cell pairs were below the unity line, indicative of the increased EPSCs in exercise-TRAPed cells (Figure 2E). The increased EPSC amplitudes could not be attributed to differences in intrinsic membrane properties or presynaptic release probability (Figure 2—figure supplement 2 and Supplementary file 1). These results indicate that dentate granule cells activated by a single bout of exercise show a laminar-specific increase in dendritic spines and in excitatory postsynaptic currents.

Activity-dependent gene expression is one of the main drivers of short- and long-term changes in synaptic function (West and Greenberg, 2011). To identify exercise-activated genes underlying the observed structural plasticity in the dentate gyrus, we isolated RNA from RFP+ nuclei of exercise-TRAPed cells (Figure 3A,B) using laser microdissection. An ensemble of 150 individual exercise-TRAPed or adjacent non-activated (RFP) mature granule cells was excised per mouse at 3 and 7 days post-exercise. Analysis of transcripts by RNASeq (Figure 3—figure supplement 1) revealed up- and down-regulated transcripts (Figure 3C, left panel, Supplementary file 2 and 3) of which approximately 150 transcripts were significantly upregulated in exercise-TRAPed neurons 3 days after exercise. Gene Ontology analysis indicated that most of the upregulated transcripts had signaling or synaptic functions. The top ten upregulated genes (Figure 3C) included several known genes involved in hippocampal function, such as the neuron-specific RNA-binding protein Elavl4 and the immediate early gene Egr1 (Akamatsu et al., 2005Jones et al., 2001). Consistent with the transient increase in dendritic spines, no transcript identified at 3 days post- exercise remained elevated at 7 days (Figure 3—figure supplement 2).Figure 3 with 3 supplementsDownload assetOpen asset

Transcriptome analysis of laser captured dentate granule cells activated by a single bout of voluntary exercise.(A) A virus expressing a CAG promoter followed by a loxP-flanked (‘floxed’) stop cassette-controlled Histone2B Monomeric Red Fluorescent Protein (flex H2B-mRFP), was injected stereotaxically into … see morehttps://doi.org/10.7554/eLife.45920.007

Figure 3—figure supplement 3Download assetOpen asset

Effect of exposure to a fixed wheel on neuronal activity and Mtss1L expression.(A) Exposure to a fixed wheel for 2 hr increased exercise-TRAPed dentate granule cells (% increase from baseline in TRAPed cells, homecage 100 ± 6 n = 5, Fixed wheel 133 ± 5, n = 5, unpaired t-test, … see morehttps://doi.org/10.7554/eLife.45920.010

Figure 3—figure supplement 2Download assetOpen asset

Real-time qPCR confirmation of upregulated genes in exercise-TRAPed cells.Six of the top 10 enriched genes (see Figure 3C) were selected for validation including the top five based on padj values, and one from the lower five padj (CDKN1A). (A) Summary real-time qPCR … see morehttps://doi.org/10.7554/eLife.45920.009

Figure 3—figure supplement 1Download assetOpen asset

Filtering, and dispersion estimation of sequencing data used for transcriptomics.(A) Log2 raw counts dataframe after filtering transcripts with rowmax < 64 counts are displayed with violin plots in blue, median counts of each sample are shown as white dots with black bars … see morehttps://doi.org/10.7554/eLife.45920.008

We focused on Mtss1-like (metastasis-suppressor 1-like, Mtss1L), a protein that has been little studied in the adult nervous system (Saarikangas et al., 2008). Mtss1L, (recently renamed to Mtss2, MTSSI-BAR domain containing 2) the most enriched transcript in our experiments, was nine-fold elevated compared to non-activated neighboring cells, as validated in exercise TRAPed cells by RT-PCR (Figure 3DFigure 3—figure supplement 2). As a control for the object novelty of the running wheel, we exposed Fos-TRAP mice for 2 hr to an identical wheel that was locked, so that the mice could explore but not run. At 3 days post-exposure, there was a small increase above baseline in the number of Fos-TRAPed cells and Mtss1L expression (Figure 3—figure supplement 3), but substantially less than exercise-TRAPed mice.

To determine the spatiotemporal pattern of Mtss1L expression, we derived KOMP Mtss1L reporter mice (Skarnes et al., 2011) in which the endogenous Mtss1Lpromoter drives bacterial beta-galactosidase (lacZ) gene expression. LacZ expression was undetectable in the dentate gyrus of KOMP Mtss1L+/- housed in their homecage, suggesting no expression of Mtss1L under baseline conditions. In contrast, exercise-induced LacZ expression peaked at 3 days post-exercise (Figure 4), confirming the activity-dependence of Mtss1L expression in the dentate gyrus. Mtss1L belongs to the BAR (Bin, Amphiphysin and Rvs, I-BAR) protein family, a class of proteins that function by promoting curvature in membranes. BAR domain proteins such as amphyphysin promote inward curvatures including invaginations that are involved in endocytosis or synaptic vesicles at presynaptic nerve terminals (Dawson et al., 2006). In contrast, I-BAR proteins promote outward structures typically seen in membrane protrusions. Thus, we hypothesized that Mtss1L expression-mediated exercise-dependent formation or rearrangement of synapses in postsynaptic dendrites.Figure 4Download assetOpen asset

Timecourse of LacZ expression in Mtss1L reporter mice.(A) Schematic representation of the experimental paradigm used for the Mtss1L reporter mice. KOMP Mtss1l +/- were either housed in their homecage or exposed to 2 hr of voluntary exercise. Brain … see morehttps://doi.org/10.7554/eLife.45920.011

As proof of principle, we first examined the localization of endogenous Mtss1L in hippocampal neurons in vitro following exposure to brain-derived neurotrophic factor (BDNF), which is upregulated by exercise and involved in activity-dependent synaptic plasticity (Vaynman et al., 2004Wrann et al., 2013). Mtss1L immunoreactivity was detectable only after BDNF treatment (Figure 5A), consistent with the activity-dependent expression pattern we observed in vivo.Figure 5 with 1 supplementDownload assetOpen asset

Induced Mtss1L expression in vitro and in vivo.(A) Primary hippocampal neurons were cultured with or without BDNF from DIV 7–14 to examine activity-dependence of Mtss1L expression. Representative images of hippocampal neurons co-stained with … see morehttps://doi.org/10.7554/eLife.45920.012

Figure 5—figure supplement 1Download assetOpen asset

Effect of Mtss1L overexpression on dendritic spine subtypes of primary hippocampal neurons in vitro.Mtss1L overexpression significantly increased the density of both thin and mushroom dendritic spines, whereas there was no difference in the density of stubby spines (n = 3, unpaired t-test, p<0.05).https://doi.org/10.7554/eLife.45920.013

Mtss1L colocalized with the somatodendritic marker MAP2 along dendrites and in dendritic spines (Figure 5A). To determine whether Mtss1L could induce spine-like protrusions, we compared spine density in cultured hippocampal neurons transfected with mCherry or mCherry-Mtss1L. At DIV 14, Mtss1L overexpression markedly increased spine-like protrusions (Figure 5B) including filopodia and mushroom spine subtypes (Figure 5—figure supplement 1). The somatodendritic pattern of overexpressed mCherry-Mtss1L overlapped the endogenous Mtss1L expression (Figure 5B, yellow). mCherry-Mtss1L-expressing dendritic spines also were labeled with co-transfected PSD-95-FingR-GFP, (Fibronectin Intrabody generated with mRNA display) that binds to endogenous PSD-95 (Gross et al., 2013). PSD-95 intrabody labeling of excitatory synapses in living neurons indicated that the protrusions induced by Mtss1L also contain postsynaptic proteins (Figure 5C). In vivo, overexpression of mCherry- Mtss1lL by DNA electroporation at P0 increased spine density of mature dentate granule cells at P21 (Figure 5D). These results indicate that Mtss1L is expressed in dendrites and can induce spine-like protrusions, consistent with a putative role in synaptic plasticity.

To determine whether Mtss1L was responsible for the increase in synapses in exercise-TRAPed cells, we used a lentivirus expressing shRNAs targeting Mtss1L. Validating the efficacy of the shRNAs, shMtss1L reduced mCherry-Mtss1L mRNA and protein expression in HEK293T cells and in primary hippocampal neurons treated with BDNF (Figure 6—figure supplement 1). To knockdown Mtss1L in vivo (Figure 6A), a combination of two lentiviral shMtss1L-GFP constructs or a shscramble-GFP were injected into the dentate gyrus of Fos-TRAP mice. Three weeks post-viral injection, we assessed spine density and excitatory synaptic function in TdT+ (exercise-TRAPed) granule cells that also co-expressed GFP as a marker for shRNA expression. At 3 days post-exercise, knockdown of Mtss1Loccluded the exercise-induced increase in dendritic spines in the OML (Figure 6Bmiddle panel top, and right panel). The shscramble-GFP, injected into the contralateral dentate gyrus of the same mice, had no effect (Figure 6B right panel). Viral knockdown of Mtss1L in exercise-TRAPed cells also prevented the increase in evoked EPSCs in simultaneous paired recordings from TdT and TdT+/GFP+ granule cells (Figure 6C–D). The amplitude of EPSCs following viral knockdown in exercise-TRAPed cells was the same as neighboring cells that were not activated by exercise (Figure 6D, right panel). Intrinsic membrane properties were not affected by Mtss1L knockdown (Supplementary file 1). Figure 6E includes the results from Figure 2 (‘exercise-TRAPed OML’ (red) and ‘exercise-TRAPED MML’ (black), compared to the effects of Mtss1L shRNA (yellow), demonstrating that knockdown of Mtss1L was necessary to explain the exercise-induced increase in excitatory synapses. Importantly, evoked EPSCs in granule cells that only expressed GFP +shRNA were unaffected, demonstrating that the effect of Mtss1L was dependent on activity-dependent expression (Figure 6—figure supplement 2).Figure 6 with 2 supplementsDownload assetOpen asset

Mtss1L knockdown in exercise-TRAPed cells blocked the exercise-induced increase in dendritic spines and synaptic activity at 3 days post-exercise.(A) Effects of Mtss1L knockdown on the spine density of exercise-TRAPed cells were assessed by stereotaxically injecting a control shScramble-GFP lentivirus into the left hemisphere and a … see morehttps://doi.org/10.7554/eLife.45920.014

Figure 6—figure supplement 2Download assetOpen asset

shRNA-Mtss1L did not alter evoked EPSCs in granule cells that were not exercise- TRAPed.(A) Schematic of paired dentate granule cell recordings. EPSCs were evoked with a bipolar stimulation electrode in the OML. (B) Representative EPSCs from a paired control granule cell (GFP, black … see morehttps://doi.org/10.7554/eLife.45920.016

Figure 6—figure supplement 1Download assetOpen asset

Mtss1L shRNA knockdown efficiency.(A) shRNA knockdown efficiency was first screened using HEK293T cells overexpressing Mtss1L after transduction with lentiviral construct FUGW-mcherry-T2A-Mtss1L. Knockdown efficiency of the … see morehttps://doi.org/10.7554/eLife.45920.015

Discussion

Our experiments were designed to test the cellular and molecular response to acute exercise with an emphasis on time periods during which synapses might form or reorganize. This approach differs from studies of sustained or chronic exercise that likely involve systemic as well as neural mechanisms (Vivar et al., 2013Voss et al., 2013van Praag and Christie, 2015). Such studies have shown effects of exercise on many aspects of hippocampal function, including neurogenesis, synaptic plasticity, structural changes at synapses and dendritic spines as well as behavioral effects on learning and memory (Mandolesi et al., 2018Saraulli et al., 2017). Our goal was to examine the transcriptional response in the days following acute exercise, which led to the identification of a novel effector of structural plasticity, Mtss1L.

Although the Fos-TRAP method is limited by the time required for reporter expression (ca. 1 day post-exercise), the immediate early gene Egr1 was upregulated (Figure 3C), indicating that our protocol detected activity-dependent gene expression in mature granule cells. Although introduction of the running wheel for 2 hr itself could act as a novel object, there was a small increase in Fos-TRAPed cells when the wheel was fixed to prevent running. These results indicate that exercise is a particularly strong stimulus for activation of granule cells, but as expected other stimuli can also activate dentate granule cells (Ryan et al., 2015). Adult-generated granule cells in the subgranular zone were not activated by 2 hr of exercise (data not shown). Although it is well known that chronic exercise increases adult neurogenesis (van Praag, 2008), progenitors and newborn neurons do not receive direct excitatory perforant path input for several weeks (Overstreet et al., 2004), perhaps explaining their lack of activation in our experiments.

Our results provide the first evidence for activity-dependent expression of an I-BAR protein as well as a role in experience-dependent remodeling of synapses. However, I-BAR proteins including MIM (Mtss1L) and IRSp53 can affect constitutive dendritic spine formation (Saarikangas et al., 2015Choi et al., 2005). For example, MIM/Mtss1, is involved in cerebellar synapse formation via PIP2-dependent membrane curvature and subsequent Arp2/3-mediated action polymerization (Saarikangas et al., 2015). Expression of Mtss1L in neurons has gone largely undetected, likely a result of the previously unrecognized activity-dependence. However, Mtss1L has been detected in radial glial cells during development and implicated in glial membrane protrusions and end-feet (Saarikangas et al., 2008). I-BAR protein function at synapses is thought to be mediated by several interaction domains including the N-terminal I-BAR domain and a C-terminal actin-monomer-binding WH2 domain (Zhao et al., 2011), and may depend on slice variants. For example, the effects of MIM in cerebellar neurons is splice-variant specific (Sistig et al., 2017). Mtss1L also has two known splice variants, both of which were targeted in our overexpression and knockdown experiments. It will be interesting to investigate how protein-protein interactions and splice variants of Mtss1L contribute to their role in synaptic remodeling.

At a circuit level, the laminar-specific increase in synaptic function suggests that acute exercise had a network-specific effect. Entorhinal inputs to the outer molecular layer, the distal dendrites of mature granule cells, have been previously associated with contextual information and particularly the ‘how’ and ‘when’ aspects of encoding memories (Tsao et al., 2018). How might these results relate to the beneficial effects of exercise? One possibility consistent with our data is that exercise acts as a preconditioning signal that primes exercise-activated neurons for contextual information incoming during the several days following exercise. This represents a broader time window than is usually associated with short-term plasticity. For example, human studies give support for the idea that exercise within 4 hr of a learning task improved memory performance (van Dongen et al., 2016). It will be interesting to examine if exercise enhances the pattern of granule cell responses to spatial or context-specific tasks. Our identification of Mtss1L as an activity-dependent I-BAR domain protein makes it ideally suited to act as an early mediator of structural plasticity following neural activity.Materials and methods

Mice

All procedures were performed according to the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were in compliance with approved IACUC protocols at Oregon Health and Science University. Both female and male mice from a C57BL6/J background were used for experiments, aged 6–8 weeks at the time of surgery. TRAP mice were heterozygous for the cFoscreERT2 allele (Guenthner et al., 2013); some were also heterozygous for the B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)/Hze/J(Ai14;JAX#007908) allele for experiments involving tdTomato labeling. Cryopreserved Mtss1ltm1a(KOMP)Wtsisperm was obtained from the Knockout Mouse Project (KOMP) Repository (The Knockout Mouse Project, Mouse Biology Program, University of California, Davis, CA) under the identifier CSD79567. The Mtss1ltm1a(KOMP)Wtsi mouse line was re-derived by in vitro fertilization at the OHSU transgenic core. Genotype was confirmed by PCR. Mtss1L (recently renamed to Mtss2, MTSS I-BAR domain containing 2) deletion in Mtss1L-/- KO KOMP mice was confirmed by RT-qPCR and immunohistochemistry in the cerebellum. Cerebellar Purkinje cells, perhaps because of their high basal firing rate, are the only cells in the brain with detectable basal Mtss1L expression. Mtss1L mRNA and protein levels were undetectable in the cerebellum of Mtss1L-/- KO KOMP mice. The KOMP allele contains a Neo cassette driven by a mouse phosphoglycerate kinase promoter (PGK), which is bidirectional and may interefere with gene expression. Thus, for the generation of the Mtss1L+/- reporter mice, the Neo cassette was removed in a tissue-specific manner by stereotaxically injecting an AAV nuGFP-Cre PGK into the dentate gyrus of Mtss1L-/- KO KOMP mice 3 weeks prior to experiments. All mice were housed in plastic cages with disposable bedding on a standard light cycle with food and water available ad libitum.

Stereotaxic injections

Mice were anesthetized using an isoflurane delivery system (Veterinary Anesthesia Systems Co.) by spontaneous respiration, and placed in a Kopf stereotaxic frame. Skin was cleaned with antiseptic and topical lidocaine was applied before an incision was made. The dentate gyrus was targeted by placing Burr holes at x:±1.1 mm, y: −1.9 mm from bregma. Using a 10 µl Hamilton syringe with a 30 ga needle and the Quintessential Stereotaxic Injector (Stoelting), 2 µl mixed viral stock (1 µl of each virus) was delivered at 0.25 µl/min at z-depths of 2.5 and 2.3 mm. The syringe was left in place for 1 min after each injection before slow withdrawal. The skin above the injection site was closed using veterinary glue. Animals received post-operative analgesia with topical lidocaine and flavored acetaminophen in the drinking water.

TRAP induction

Tamoxifen was dissolved at 20 mg/ml in corn oil by sonication at 37°C for 5 min. The dissolved tamoxifen was then stored in aliquots at –20°C for up to several weeks or used immediately. The dissolved solution was injected intraperitoneally at 150 mg/kg. For exercise-TRAP, tamoxifen was administered 23 hr before exposure to the running wheel. Experiments were begun 48 hr after tamoxifen administration to allow for reporter expression.

Voluntary exercise and fixed wheel protocol

Both homecage and exercise groups were housed together until 7 days before the experiment, then they were singled housed in an oversized (rat) sedentary cages (43 × 21.5 cm2) to allow acclimation in the novel environment before tamoxifen administration. At 23 hr post-tamoxifen injection, a running wheel (free or locked) was introduced in the cage of animals in the exercise group and mice had free access to running or exploring for 2 hr at the beginning of the dark period, after which the running wheel was removed from the cage. Total distance (km) was measured using an odometer. All mouse groups were handled for 5 days before tamoxifen administration.

Immunohistochemistry

Mice were terminally anesthetized, transcardially perfused with saline and 20 ml of 4% paraformaldehyde (PFA), and brains were post-fixed overnight. Coronal sections (100 μm) of the hippocampus were collected and permeabilized in 0.4% Triton in PBS (PBST) for 30 min. Sections were then blocked for 30 min with 5% horse serum in PBST and incubated overnight (4°C) with primary antibody in 5% horse serum/PBST. After extensive washing, sections were incubated with the appropriate secondary antibody conjugated with Alexa 488, 568 or 647 (Molecular Probes), for 2hrs at room temperature. They were then washed in PBST (2 × 10 min) and mounted with Dapi Fluoromount-G (SouthernBiotech). The primary antibodies used were: anti-c- fos (1:500, Santa-Cruz), anti-tdTomato (1:500, Clontech), anti-MAP2 (1:500, Sigma), anti-ABBA/Mtss1L (1:500, Millipore), anti-VGLUT2 (1:500, Synaptic Systems) and anti-beta-galactosidase (1:20, Developmental Studies Hybridoma Bank). All antibodies have been well characterized in prior studies in our laboratory, and staining was not observed when the primary antibody was omitted.

Imaging and morphological analysis

For imaging we used an LSM 7 MP laser scanning microscope (Carl Zeiss MicroImaging; Thornwood, NY). All cell and dendritic spine counting and dendritic arbor tracing were done manually with ImageJ and Imaris (National Institutes of Health; Bethesda, MD). For quantification of immunopositive cells, six hippocampal slices at set intervals from dorsal to ventral were stained per animal; 3–6 animals were analyzed per group. A 49 μm z-stack (consisting of seven optical sections of 7 μm thickness) was obtained from every slice. Positive cells were counted per field from every z-stack, averaged per mouse and the results were pooled to generate group mean values. For analysis of spine density of dentate granule cells, sections were imaged with a 63x objective with 2.5x optical zoom. The span of z-stack was tailored to the thickness of a single segment of dendrite with 0.1 µm distance between planes. Dendritic spines were imaged and analyzed in the middle (MML) and outer molecular (OML) layers of the dentate gyrus. The MML and OML were distinguished based on the pattern of VGluT2 immunofluorescence, which begins at the border between the inner molecular layer and middle molecular layer. MML dendritic segments were therefore imaged at the beginning of the VGluT2 staining nearest the granule cell body layer, whereas OML dendritic segments were imaged at the distal tip of the molecular layer. The same microscope settings (laser intensity and gain) were used for each experimental group analyzed. Slides were coded and imaged by an investigator blinded to experimental condition.

Laser Capture Microdissection (LCM)

To obtain nuclei of exercise-TRAPed cells, fresh frozen coronal brain sections (12 µm) were collected by cryostat sectioning on polyethylene napthalate membrane slides. Sections were fixed for 1 min in 75% ethanol, followed by a final wash in 100% ethanol for 1 min. Pools of 150 RFP+ and RFP individual cells were laser captured from the granular cell layer of the dentate gyrus of each mouse using a Leica Microsystem LMD system under a HC PL FL L 63/0.60 XT objective and collected in lysis buffer (50 μl RLT buffer, Qiagen). Total RNA from LCM samples was isolated separately from each animal.

RNA extraction and RNAseq library preparation

RNA was extracted from laser-captured pooled nuclei using RNeasy mini-elute column with a modified protocol. Briefly, cells were picked from laser capture microscopy onto caps of 0.5 ml Eppendorf tubes, 50 μl RLT buffer was added immediately, and placed on ice. After spinning down the samples, 300 μl RLT was added to each sample, mixed well and vortexed for 30 s. After a brief spin, 2 ng tRNA was added as carrier and 625 µl 100% ETOH was added into each sample and mixed well. After a quick spin, samples were loaded onto RNeasy mini-elute columns, washed, dried and eluted in 10 μl RNAse-free water. 8 μl RNA was used for reverse transcription using Superscribe reverse transcriptase 2 ul, DTT 0.1M 0.5 ul, 5x RT buffer 4 μl at 42°C for 1.5 hr then heat inactivated at 75°C for 20 min (self-developed protocol for RNA extraction, superscribe reverse transcriptase was from Clontech, protocol adopted from manufacturer’s protocol for smarter single-cell RNAseq v4). TSO (AAGCAGTGGTATCAACGCAGAGTACrG +GrG) was ordered from Exicon. After RNA, PCR was carried out using Seqamp DNA polymerase and amplification PCR primer (AAGCAGTGGTATCAACGCAGAGTAC). Half of amplified cDNA was used for qPCR and the other half made into sequencing libraries using Nextera XT DNA library prep kit (Illumina) Quality of cDNA libraries were checked on Bioanalyzer using DNA high sensitivity Chip. 2 nM library dilutions were mixed and denatured, 1.8 pmol mixed library was sequenced on Nextseq500 (Illumina). Libraries were sequenced to a depth of 14–30 million reads. Alignment rate of total reads was above 90% across all samples. Gene level coverage at 1x was ~10000 genes and even among all samples with no 3’ or 5’ end bias.

RNAseq analysis

After sequencing, sequencing quality was checked by fastqc, raw reads were aligned with STAR 2.5b on Illumina Basespace. Raw reads were then plotted as a violin plot using the R ggplot2 package. Genes with reads lower than 64 in all samples were filtered away and dataframe was replotted to check data distribution. Individual samples that differed significantly in their count distribution due to technical issues were discarded from further analysis. Data dispersion and differential expression analysis was done on filtered reads using DEseq2 unpaired analysis. FDR and <0.15 fold enrichment and > 1.5 fold were considered as enriched genes and were plotted in MA-plot using R script. Genes enriched in TRAPed cells at 3 days post exercise were further analyzed by PantherGO for GO terms enrichment (release 20160321, GO Ontology database released 2016-05-20); protein-protein reactions analyzed by Cytoscape application Biogenet.

Real-time qPCR

To quantify gene expression levels, amplified cDNA was mixed with the iQ5 SYBR Green PCR master mix (Biorad) and 5 pmol of both forward and reverse primers were used. For qPCR of our miRNA-based shRNA, miRNA was converted to cDNA using the QuantiMiR reverse transcription kit (System Biosciences, Mountain View, CA). Briefly, RNA was polyadenylated with ATP by poly(A) polymerase at 37°C for 1 hr and reverse transcribed using 0.5 µg of poly(T) adapter primer. Each miRNA was detected by the mature DNA sequence as the forward primer and a 3′ universal reverse primer provided in the QuantiMir RT kit. Human small nuclear U6 RNA was amplified as an internal control. qPCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems). All qPCR performed using SYBR Green was conducted at 50°C for 2 min, 95°C for 10 min, and then 40 cycles of 95°C for 15 s and 60°C for 1 min. The specificity of the reaction was verified by melt curve analysis. Relative expression was calculated using mouse Ubc or 18S as internal controls as specified in the Figure legends. A table of primers is included as Supplementary file 4.

Primary neuronal hippocampal cultures and in vitro transfections

Hippocampi from E18-19 embryos were isolated as described previously (Seibenhener and Wooten, 2012) and placed on ice. The tissue was chopped into 1 mm cubes with fine scissors and transferred to a 15-ml tube using a Pasteur pipette. This tube was placed in a water bath at 37°C with the papain solution, separately, and both were allowed to equilibrate at this temperature for 5 min. The tissue was then carefully transferred into the papain solution and placed on an orbital shaker at 100 rpm at 37°C for 15 min. The tissue was then gently transferred from the papain solution into a 15-ml tube containing 2 ml HBSS. This step was repeated 2X to remove any residual papain. The tissue was then triturated using fire polished Pasteur pipettes. Following trituration and centrifugation, the single-cell suspension was seeded on poly- D-Lysine coated coverslips in 24-well plates at 104 cells/well in Neurobasal Plating Media with B27 Supplement [1 ml/50 ml], 0.5 mM glutamine solution, penicillin(10,000 units/ml)/streptomycin (10,000 µg/ml) [250 µl/50 ml], 1 mM HEPES (MW238.3 g/mol), 10% Heat-Inactivated horse serum. HI-horse serum was removed by half- changes of the plating media beginning at 24 hr.

For transfection of cultured neurons, DNA-Lipofectamine 2000 complexes were prepared as follows: 1 µg of DNA was diluted in 50 µl of Neurobasal medium and 2 µl of Lipofectamine 2000 was diluted in another 50 µl of Neurobasal medium. Five min after dilution of Lipofectamine 2000, the diluted DNA was combined with the diluted lipid. The solutions were gently mixed and then left for 20 min at room temperature to allow the DNA–Lipofectamine 2000 lipoplexes to form. 100 µl of transfection complex was added to each well containing cells and medium, and the cells were incubated at 37°C in a humidified incubator with 5% CO2 for 1 hr after which transfection media was changed. Transfection efficiency was assayed 48 hr post-transfection by fluorescence microscopy.

In vivo electroporation into postnatal granule cells of the dentate gyrus

Postnatal day 0 (P0) electroporation of the dentate gyrus was performed according to a previously published method (Ito et al., 2014). In brief, mice were anesthetized by hypothermia, and then a sharp glass electrode with a beveled tip containing plasmid (1 µg/µl in TE mixed with 0.05% Fast Green) was inserted through skin and skull. One µl of DNA solution was injected into the lateral ventricle (LV). Correct injection was confirmed by trans-cranial visualization of Fast Green in the LV in the dissecting microscope. Successfully injected pups were immediately electroporated with tweezer electrodes (5 mm platinum) positioned onto the brains as described by Ito et al. (2014). Five pulses of 100 V and of 50 ms duration were given at 950 ms intervals. Electroporated animals were placed in a recovery chamber at 37°C for several minutes and then returned to their mother.

Plasmid construction

PLVX-cherry-C1 plasmid was from Clontech and Mtss1L coding region was cloned into the C-terminus of mCherry between BsrG1 and SmaI sites to generate fusion construct of PLVX-cherryC1-Mtss1L (Mtss1L coding region sequence Accession number B), FUCW-T2A-Mtss1L was constructed using NEB HiFi DNA builder assembly kit. shABBA constructs were either obtained from Dharmacon or designed by Biosettia and subcloned into PLV-Ubc-GFP-mU6-shRNA using NEB HIFI DNA assembly mix. The folllowing shRNA sequences were used: Mtss1L1:AAAAGGCCGTTTCTGCACCTTTATTGGATCCAATAAAGGTGCAGAAACGGCC, Mtss1L2 (miRNA-based shRNA): TCTCTACTAGGCTGTGCCT, Scramble:AAAAGCTACACTATCGAGCAATTTTGGATCCAAAATTGCTCGATAGTGTAGC.

Slice physiology

Acute brain slices were prepared as previously described (Hendricks et al., 2017). In summary, 8-week-old male and female mice were anesthetized with 4% isoflurane and injections of 1.2% avertin (Sigma-Aldrich). Mice were perfused with 10 mL of ice-cold cold N-methyl-D-glucamine (NMDG)-based cutting solution, containing the following (in mM): 93 NMDG, 30 NaHCO3, 24 glucose, 20 HEPES, 5 Na-ascorbate, 5 N-acetyl cysteine, 3 Na-pyruvate, 2.5 KCl, two thiourea, 1.2 NaH2PO4, 10 MgSO4, and 0.5 CaCl2. Transverse 300-µm-thick hippocampal sections were cut in ice-cold NMDG solution on a Leica VT1200S vibratome. Slices recovered in warm (34°C) NMDG solution for 15 min. Slices were transferred to room temperature in standard ACSF and allowed to recover for at least 1 hr prior to recording. Dentate granule cell whole-cell recordings were made with 3–5 MΩ borosilicate glass pipets filled with a Cs+-based internal solution containing (in mM): 113 Cs-gluconate, 17.5 CsCl, 10 HEPES, 10 EGTA, 8 NaCl, 2 Mg-ATP, 0.3 Na-GTP, 0.05 Alexa Fluor 488, pH adjusted to 7.3 with CsOH. Osmolarity was adjusted to 295 mOsm and QX-314-Cl (5 mM; Tocris Bioscience) was included to block unclamped action potentials. The junction potential was 8 mV and left uncorrected. Granule cells were visually identified on an Olympus BX-51WI microscope using infrared differential interference contrast imaging. To ensure relatively equal stimulation intensity between cells during paired simultaneous tdT +and tdT- recordings, neighboring tdT +and tdT- (control) cells were selected. Cells were only considered ‘neighbors’ if they were within roughly ±2 cell bodies distance apart in the x and y planes, and roughly ±1 cell body distance in the z plane. Granule cells were filled with AlexaFluor 488 to ensure dendritic overlap. Bi-polar stimulating electrodes (FHC) were placed in distally in the OML and medially in the MML, to ensure OML and MML-specific stimulation of lateral and medial perforant path, respectively (Woods et al., 2018). Electrical stimulation was delivered with a constant current stimulator (Digitimer, Inc); intensity was tittered to produce 50–100 pA EPSCs in tdT- cells. Proximity to the stimulating electrode and recording configuration was randomly assigned. Cells were voltage-clamped to −70 mV and signals were amplified using two AxoClamp 200B amplifiers (Molecular Devices), Bessel filtered at 5 kHz, and captured at 10 kHz with an analog-to-digital converter (National Instruments). Data were collected and analyzed in Igor Pro eight using the Igor NIDAQ Tools MX script package (Wavemetrics). Averages were the mean of 15 consecutive sweeps.

Cell lines and culture

HEK293T cells were purchased from CH3 Biosystems (#920001) and maintained in DMEM media supplemented with 10% fetal bovine serum, non-essential amino acid and penicillin-streptomycin using standard procedures.

The identity of the HEK 293 T cell line was provided and authenticated by CH3 Biosystems (#920001), where the line was purchased from. Mycoplasma screening was negative.

Statistical analysis

Sample sizes were based on pilot experiments with an effect size of 20% and a power of 0.8. Littermates were randomly assigned to control or exercise groups. Criteria were established in advance based on pilot studies for issues including data inclusion, outliers, and selection of endpoints. Criteria for excluding animals from analysis are listed in the methods. Mean ± SD was used to report statistics for all apart from electrophysiology experiments where Mean ± SE was used. The choice of statistical test, test for normality, definition of N, and multiple hypothesis correction where appropriate are described in the figure legends. Unless otherwise stated, all statistical tests were two-sided. Significance was defined as p<0.05. All statistical analyses were performed in Prism or Igor Pro 8.References

  1. 1The RNA-binding protein HuD regulates neuronal cell identity and maturation
    1. W Akamatsu
    2. H Fujihara
    3. T Mitsuhashi
    4. M Yano
    5. S Shibata
    6. Y Hayakawa
    7. HJ Okano
    8. S Sakakibara
    9. H Takano
    10. T Takano
    11. T Takahashi
    12. T Noda
    13. H Okano
    (2005)PNAS 102:4625–4630.https://doi.org/10.1073/pnas.0407523102
  2. 2Running improves pattern separation during novel object recognition
    1. L Bolz
    2. S Heigele
    3. J Bischofberger
    (2015)Brain Plasticity 1:129–141.https://doi.org/10.3233/BPL-150010
  3. 3Regulation of dendritic spine morphogenesis by insulin receptor substrate 53, a downstream effector of Rac1 and Cdc42 small GTPases
    1. J Choi
    2. J Ko
    3. B Racz
    4. A Burette
    5. JR Lee
    6. S Kim
    7. M Na
    8. HW Lee
    9. K Kim
    10. RJ Weinberg
    11. E Kim
    (2005)Journal of Neuroscience 25:869–879.https://doi.org/10.1523/JNEUROSCI.3212-04.2005
  4. 4Running enhances spatial pattern separation in mice
    1. DJ Creer
    2. C Romberg
    3. LM Saksida
    4. H van Praag
    5. TJ Bussey
    (2010)PNAS 107:2367–2372.https://doi.org/10.1073/pnas.0911725107
  5. 5Bar domain proteins: a role in Tubulation, scission and actin assembly in clathrin-mediated endocytosis
    1. JC Dawson
    2. JA Legg
    3. LM Machesky
    (2006)Trends in Cell Biology 16:493–498.https://doi.org/10.1016/j.tcb.2006.08.004
  6. 6Recombinant probes for visualizing endogenous synaptic proteins in living neurons
    1. GG Gross
    2. JA Junge
    3. RJ Mora
    4. HB Kwon
    5. CA Olson
    6. TT Takahashi
    7. ER Liman
    8. GC Ellis-Davies
    9. AW McGee
    10. BL Sabatini
    11. RW Roberts
    12. DB Arnold
    (2013)Neuron 78:971–985.https://doi.org/10.1016/j.neuron.2013.04.017
  7. 7Permanent genetic access to transiently active neurons via TRAP: targeted recombination in active populations
    1. CJ Guenthner
    2. K Miyamichi
    3. HH Yang
    4. HC Heller
    5. L Luo
    (2013)Neuron 78:773–784.https://doi.org/10.1016/j.neuron.2013.03.025
  8. 8Microstructure of a spatial map in the entorhinal cortex
    1. T Hafting
    2. M Fyhn
    3. S Molden
    4. MB Moser
    5. EI Moser
    (2005)Nature 436:801–806.https://doi.org/10.1038/nature03721
  9. 9Major dissociation between medial and lateral entorhinal input to dorsal hippocampus
    1. EL Hargreaves
    2. G Rao
    3. I Lee
    4. JJ Knierim
    (2005)Science 308:1792–1794.https://doi.org/10.1126/science.1110449
  10. 10Short-Term depression of sprouted mossy fiber synapses from Adult-Born granule cells
    1. WD Hendricks
    2. Y Chen
    3. AL Bensen
    4. GL Westbrook
    5. E Schnell
    (2017)The Journal of Neuroscience 37:5722–5735.https://doi.org/10.1523/JNEUROSCI.0761-17.2017
  11. 11Establishment of an in vivo electroporation method into postnatal newborn neurons in the dentate gyrus
    1. H Ito
    2. R Morishita
    3. I Iwamoto
    4. K Nagata
    (2014)Hippocampus 24:1449–1457.https://doi.org/10.1002/hipo.22325
  12. 12A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories
    1. MW Jones
    2. ML Errington
    3. PJ French
    4. A Fine
    5. TV Bliss
    6. S Garel
    7. P Charnay
    8. B Bozon
    9. S Laroche
    10. S Davis
    (2001)Nature Neuroscience 4:289–296.https://doi.org/10.1038/85138
  13. 13Spatial selectivity of unit activity in the hippocampal granular layer
    1. MW Jung
    2. BL McNaughton
    (1993)Hippocampus 3:165–182.https://doi.org/10.1002/hipo.450030209
  14. 14Pattern separation in the dentate gyrus and CA3 of the hippocampus
    1. JK Leutgeb
    2. S Leutgeb
    3. MB Moser
    4. EI Moser
    (2007)Science 315:961–966.https://doi.org/10.1126/science.1135801
  15. 15Effects of physical exercise on cognitive functioning and wellbeing: biological and psychological benefits
    1. L Mandolesi
    2. A Polverino
    3. S Montuori
    4. F Foti
    5. G Ferraioli
    6. P Sorrentino
    7. G Sorrentino
    (2018)Frontiers in Psychology 9:509.https://doi.org/10.3389/fpsyg.2018.00509
  16. 16A transgenic marker for newly born granule cells in Dentate Gyrus
    1. LS Overstreet
    2. ST Hentges
    3. VF Bumaschny
    4. FS de Souza
    5. JL Smart
    6. AM Santangelo
    7. MJ Low
    8. GL Westbrook
    9. M Rubinstein
    (2004)Journal of Neuroscience 24:3251–3259.https://doi.org/10.1523/JNEUROSCI.5173-03.2004
  17. 17Acute effects of aerobic exercise promote learning
    1. R Perini
    2. M Bortoletto
    3. M Capogrosso
    4. A Fertonani
    5. C Miniussi
    (2016)Scientific Reports 6:25440.https://doi.org/10.1038/srep25440
  18. 18Memory. Engram cells retain memory under retrograde amnesia
    1. TJ Ryan
    2. DS Roy
    3. M Pignatelli
    4. A Arons
    5. S Tonegawa
    (2015)Science 348:1007–1013.https://doi.org/10.1126/science.aaa5542
  19. 19ABBA regulates plasma-membrane and actin dynamics to promote radial glia extension
    1. J Saarikangas
    2. J Hakanen
    3. PK Mattila
    4. M Grumet
    5. M Salminen
    6. P Lappalainen
    (2008)Journal of Cell Science 121:1444–1454.https://doi.org/10.1242/jcs.027466
  20. 20MIM-Induced membrane bending promotes dendritic spine initiation
    1. J Saarikangas
    2. N Kourdougli
    3. Y Senju
    4. G Chazal
    5. M Segerstråle
    6. R Minkeviciene
    7. J Kuurne
    8. PK Mattila
    9. L Garrett
    10. SM Hölter
    11. L Becker
    12. I Racz
    13. W Hans
    14. T Klopstock
    15. W Wurst
    16. A Zimmer
    17. H Fuchs
    18. V Gailus-Durner
    19. M Hrabě de Angelis
    20. L von Ossowski
    21. T Taira
    22. P Lappalainen
    23. C Rivera
    24. P Hotulainen
    (2015)Developmental Cell 33:644–659.https://doi.org/10.1016/j.devcel.2015.04.014
  21. 21The long run: neuroprotective effects of physical exercise on adult neurogenesis from youth to old age
    1. D Saraulli
    2. M Costanzi
    3. V Mastrorilli
    4. S Farioli-Vecchioli
    (2017)Current Neuropharmacology 15:519–533.https://doi.org/10.2174/1570159X14666160412150223
  22. 22Conjunctive representation of position, direction, and velocity in entorhinal cortex
    1. F Sargolini
    2. M Fyhn
    3. T Hafting
    4. BL McNaughton
    5. MP Witter
    6. MB Moser
    7. EI Moser
    (2006)Science 312:758–762.https://doi.org/10.1126/science.1125572
  23. 23Isolation and culture of hippocampal neurons from prenatal mice
    1. ML Seibenhener
    2. MW Wooten
    (2012)Journal of Visualized Experiments, 10.3791/3634, 22871921.
  24. 24A combinatorial model for dentate gyrus sparse coding
    1. W Severa
    2. O Parekh
    3. CD James
    4. JB Aimone
    (2017)Neural Computation 29:94–117.https://doi.org/10.1162/NECO_a_00905
  25. 25Mtss1 promotes maturation and maintenance of cerebellar neurons via splice variant-specific effects
    1. T Sistig
    2. F Lang
    3. S Wrobel
    4. SL Baader
    5. K Schilling
    6. B Eiberger
    (2017)Brain Structure and Function 222:2787–2805.https://doi.org/10.1007/s00429-017-1372-8
  26. 26A conditional knockout resource for the genome-wide study of mouse gene function
    1. WC Skarnes
    2. B Rosen
    3. AP West
    4. M Koutsourakis
    5. W Bushell
    6. V Iyer
    7. AO Mujica
    8. M Thomas
    9. J Harrow
    10. T Cox
    11. D Jackson
    12. J Severin
    13. P Biggs
    14. J Fu
    15. M Nefedov
    16. PJ de Jong
    17. AF Stewart
    18. A Bradley
    (2011)Nature 474:337–342.https://doi.org/10.1038/nature10163
  27. 27Integrating time from experience in the lateral entorhinal cortex
    1. A Tsao
    2. J Sugar
    3. L Lu
    4. C Wang
    5. JJ Knierim
    6. MB Moser
    7. EI Moser
    (2018)Nature 561:57–62.https://doi.org/10.1038/s41586-018-0459-6
  28. 28Effects of chronic treadmill running on neurogenesis in the dentate gyrus of the hippocampus of adult rat
    1. M Uda
    2. M Ishido
    3. K Kami
    4. M Masuhara
    (2006)Brain Research 1104:64–72.https://doi.org/10.1016/j.brainres.2006.05.066
  29. 29Physical exercise performed four hours after learning improves memory retention and increases hippocampal pattern similarity during retrieval
    1. EV van Dongen
    2. IHP Kersten
    3. IC Wagner
    4. RGM Morris
    5. G Fernández
    (2016)Current Biology 26:1722–1727.https://doi.org/10.1016/j.cub.2016.04.071
  30. 30Neurogenesis and exercise: past and future directions
    1. H van Praag
    (2008)NeuroMolecular Medicine 10:128–140.https://doi.org/10.1007/s12017-008-8028-z
  31. 31Tracking effects of exercise on neuronal plasticity
    1. H van Praag
    2. B Christie
    (2015)Brain Plasticity 1:3–4.https://doi.org/10.3233/BPL-159001
  32. 32Hippocampal BDNF mediates the efficacy of exercise on synaptic plasticity and cognition
    1. S Vaynman
    2. Z Ying
    3. F Gomez-Pinilla
    (2004)European Journal of Neuroscience 20:2580–2590.https://doi.org/10.1111/j.1460-9568.2004.03720.x
  33. 33All about running: synaptic plasticity, growth factors and adult hippocampal neurogenesis
    1. C Vivar
    2. MC Potter
    3. H van Praag
    (2013)Current Topics in Behavioral Neurosciences 15:189–210.https://doi.org/10.1007/7854_2012_220
  34. 34Bridging animal and human models of exercise-induced brain plasticity
    1. MW Voss
    2. C Vivar
    3. AF Kramer
    4. H van Praag
    (2013)Trends in Cognitive Sciences 17:525–544.https://doi.org/10.1016/j.tics.2013.08.001
  35. 35Neuronal activity-regulated gene transcription in synapse development and cognitive function
    1. AE West
    2. ME Greenberg
    (2011)Cold Spring Harbor Perspectives in Biology 3:a005744.https://doi.org/10.1101/cshperspect.a005744
  36. 36Preferential targeting of lateral entorhinal inputs onto newly integrated granule cells
    1. NI Woods
    2. CE Vaaga
    3. C Chatzi
    4. JD Adelson
    5. MF Collie
    6. JV Perederiy
    7. KR Tovar
    8. GL Westbrook
    (2018)The Journal of Neuroscience 38:5843–5853.https://doi.org/10.1523/JNEUROSCI.1737-17.2018
  37. 37Exercise induces hippocampal BDNF through a PGC-1α/FNDC5 pathway
    1. CD Wrann
    2. JP White
    3. J Salogiannnis
    4. D Laznik-Bogoslavski
    5. J Wu
    6. D Ma
    7. JD Lin
    8. ME Greenberg
    9. BM Spiegelman
    (2013)Cell Metabolism 18:649–659.https://doi.org/10.1016/j.cmet.2013.09.008
  38. 38Lateral entorhinal neurons are not spatially selective in cue-rich environments
    1. D Yoganarasimha
    2. G Rao
    3. JJ Knierim
    (2011)Hippocampus 21:1363–1374.https://doi.org/10.1002/hipo.20839
  39. 39I-BAR domain proteins: linking actin and plasma membrane dynamics
    1. H Zhao
    2. A Pykäläinen
    3. P Lappalainen
    (2011)Current Opinion in Cell Biology 23:14–21.https://doi.org/10.1016/j.ceb.2010.10.005

Decision letter

  1. John HuguenardReviewing Editor; Stanford University School of Medicine, United States
  2. Ronald L CalabreseSenior Editor; Emory University, United States
  3. Paul F WorleyReviewer; Johns Hopkins University School of Medicine, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: the authors were asked to provide a plan for revisions before the editors issued a final decision. What follows is the editors’ letter requesting such plan.]

Thank you for sending your article entitled “Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L” for peer review at eLife. Your article is being evaluated by three peer reviewers, and the evaluation is being overseen by a Reviewing Editor and Ronald Calabrese as the Senior Editor.

Given the list of essential revisions, including new experiments, the editors and reviewers invite you to respond with an action plan and timetable for the completion of the additional work. We plan to share your responses with the reviewers and then issue a binding recommendation.

Summary:

The authors present work where Mtss1L is identified as an exercise induced hippocampal gene, then show modulation of Mtss1L levels changes exercise induced spine density. Overall there are few papers on I-BAR genes in the nervous system and even fewer on Mtss1L making this work potentially novel.

The authors address mechanisms contributing to exercise-induced synaptic plasticity in the hippocampus using Fos-TRAP mice to identify exercise-activated dentate granule cells. They show that brief bouts of running result in changes in spine density and synaptic strength, and they perform RNASeq to identify potential molecular mediators. shRNA knock-down of one highly-upregulated gene, Mtss1L, was sufficient to block the exercise-induced change in spines and EPSCs. Thus, they propose Mtss1L is a novel effector of activity-dependent synapse function. Overall the experiments, analysis and interpretations are convincing and the conclusions are interesting.

Essential revisions:

– The authors don’t directly show that Mtss1L expression is activity dependent. Their in vitro data suggest it is BDNF dependent, but do not show changes in firing activity cause Mtss1L expression. It is unclear how closely the synaptic changes are associated with exercise rather than then Fos-expressing status of GCs (which could occur under various conditions and in the homecage). Since the authors strongly focus on exercise and subsequent cognitive benefits in the introduction, it is important to confirm that these are exercise-mediated effects.

– Figure 2/Figure 6. All of the functional data involves comparison of TRAPed and non-TRAPed (control) GCs in the exercise condition. To confirm that the effects result from exercise, the author should address functional synaptic differences in TRAPed and control GCs in the non-exercise condition. This would address the possibility that TRAPed cells exhibit increased OML synaptic function in the absence of exercise.

– Figure 4 addresses the expression of Mtss1L in the DG in response to exercise, but the images are not very helpful. Higher magnification images are needed to illustrate the expression pattern. It is also unclear why the authors used the KOMP approach rather than the antibody shown in Figure 5A. Co-labeling of Mtss1L and Fos-TRAP before and after exercise should be obtained to confirm that it is upregulated only in Fos-TRAPed GCs.

– Results, fifth paragraph: Key reagent validation is necessary. The KOMP Mtss1Ltm1a(KOMP)Wtsi allele is reporter tagged allele with conditional potential. LacZ activity with this allele is not Cre dependent. LacZ activity can be eliminated with Flp expression. Treating with Cre will excise the Neo cassette and exons 7 and 8 leaving LacZ expressed and unaffected. Of concern is the lack of characterization of the allele and the apparently unnecessary manipulations on their animals (nuGFP-Cre injection). Additional controls need to be included that are required of those making or using an allele for the first time. The authors should more clearly explain the motivation for nuGFP-CRE line of experiments, as it is not clear in the text.

– Additionally, several sequencing and array studies suggest Mtss1L expression in neurons is ambiguous, but high in radial glia (Saarikangas et al., 2008), astrocytes (astrocyternaseq.org), oligodendrocyte progenitors (https://web.stanford.edu/group/barres_lab/brain_rnaseq.html, described in Zhang et al., 2014, J. Neurosci.). Additional experiments to better characterize Mtss1L staining would be incredibly helpful in resolving this ambiguity.

– The Mtss1L paralog Mtss1 have multiple splice variants that are biologically important controlling localization in the cell and other functions. Given the similarity one may expect similar for Mtss1L and clearly documenting the spliceform used is essential. Related, Figure 5C and D – the interpretation of these overexpression experiments will depend strongly on the spliceform of Mtss1L used. Saarikangas et al. (2015) demonstrated the Mtss1 IMD domain alone is sufficient to induce extra spines, which is almost completely identical to Mtss1L. However, Mtss1 and Mtss1L have different overexpression phenotypes, suggesting domains outside the N-terminal IMD region are biologically important. Without explaining what form of Mtss1L is being used it’s impossible for readers to determine whether these overexpression phenotypes reflect Mtss1L function, or whether a truncated form is mimicking roles established for Mtss1.

– Figure 6D. The authors show that expressing Mtss1L is sufficient to alter spines in GCs in the absence of exercise, suggesting an important contribution to on-going synaptic plasticity. Thus, it seems counter-intuitive that knockdown of Mtss1L had no effect on EPSCs in the basal condition (Figure 6—figure supplement 2). This should be explained (as it relates to the first point).

[Editors’ note: formal revisions were requested, following approval of the authors’ plan of action.]

Thank you for submitting your article “Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L” for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Ronald Calabrese as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Paul F Worley (Reviewer #3).

The reviewers have discussed the reviews and your revision plan with one another. The revision plan is generally acceptable, but there is one additional experiment, listed under essential revisions, below, that will bolster the specific claims made in the Abstract and Introduction. The Reviewing Editor has drafted this decision to help you prepare a revised submission.

Essential revisions:

The reviewers were not fully satisfied about the revision response to point 2 relating to the relationship between the authors conclusions about Mtss1L-induced synapse/spine plasticity and exercise.

There is no doubt that Fos+ cells represent an active population of GCs in the DG, sometimes referred to as “engram” cells. The Tonegawa lab has used a similar approach to show that Fos+ GCs have greater evoked EPSCs and spine density compared to Fos- GCs after a 5 min exposure to novel context (see Supplementary Figure 7 of Ryan et al., 2015). The authors should do a similar experiment – repeat the experiment of 2B in mice that have not undergone exercise – to test whether exercise is really required for this main outcome measure. The Ryan et al. data suggests that the synaptic function and spine difference between Fos+ and Fos- cells will exist in the absence of exercise (i.e. exercise is not required). The result of this experiment could differentiate whether Mtss1L is simply an activity-dependent gene downstream of Fos or whether it is specifically related to exercise-induced activity as indicated in the Abstract and Introduction. The outcome of this experiment does not change the mechanistic novelty of the role of Mtss1L in activity-dependent synaptic plasticity, but it could affect the conclusions that the authors make about this mechanism in the context of exercise. At the very least, the authors should discuss their results in the context of what has been reported about synapses/spines of Fos+ and Fos- GCs in the absence of exercise, which is very similar to what they are currently ascribing to an effect of exercise.

It is unclear how closely the synaptic changes are associated with exercise rather than then Fos-expressing status of GCs (which could occur under various conditions and in the homecage). Since the authors strongly focus on exercise and subsequent cognitive benefits in the Introduction, it is important to confirm that these are exercise-mediated effects.https://doi.org/10.7554/eLife.45920.025Author response

[Editors’ note: what follows is the authors’ plan to address the revisions.]

Essential revisions:

– The authors don’t directly show that Mtss1L expression is activity dependent. Their in vitro data suggest it is BDNF dependent, but do not show changes in firing activity cause Mtss1L expression. It is unclear how closely the synaptic changes are associated with exercise rather than then Fos-expressing status of GCs (which could occur under various conditions and in the homecage). Since the authors strongly focus on exercise and subsequent cognitive benefits in the Introduction, it is important to confirm that these are exercise-mediated effects.

We disagree with the interpretation that we do not demonstrate that Mtss1L is activity-dependent. Our experiments were specifically setup to reveal changes occurring over days, not minutes, that is, the typical time frame of activity-dependent gene expression. Whether Mtss1L is induced by short-term activity is not the point; what’s important is that Mtss1L expression occurs over a period of days. So the BDNF response is on point—activity induces expression of BDNF, which then induces expression of Mtss1L. What’s interesting about our results is the focus on a brief period exercise, which few investigators have examined. The point of the paper is to examine genes that were activated by exercise, not to claim that exercise is the only stimulus that can activate dentate granule cells. We can adjust the text to clarify this issue, but we see no point in additional experiments.

Additionally, Fos is universally accepted as a measure of neural activity, and we show definitively in Figure 1 that the single bout of exercise causes a 5-fold increase in Fos labeled cells within the tamoxifen-induced time window, and that the expression in homecage is very low given the sparse nature of the dentate gyrus. We confirm in vitro in Figure 1—figure supplement 1 that neurons in the Fos-TRAP mouse are similarly sensitive to depolarization as Fos immunohistochemistry. Thus our view is that this result is clear-cut and shows definitively that our stimulus (exercise) led to the Fos-TRAP labeled cells used for the analysis. We agree that a small fraction of Fos-TRAP labeled could have been activated within the taxomifen time window by a different stimulus, but that would not affect any of our conclusions. The suggestion to measure firing rate of the Fos-TRAP labeled cells is not a feasible experiment in vivo and would only show that Fos is activated by neural activity.

– Figure 2/Figure 6. All of the functional data involves comparison of TRAPed and non-TRAPed (control) GCs in the exercise condition. To confirm that the effects result from exercise, the author should address functional synaptic differences in TRAPed and control GCs in the non-exercise condition. This would address the possibility that TRAPed cells exhibit increased OML synaptic function in the absence of exercise.

As seen in Figure 2A, there is no difference in spine density between OML and MML in homecage Fos-TRAPed cells (i.e. in the absence of the exercise protocol). For the convenience of the reviewer we have included Author response image 1with direct comparison of the data. Additionally, we have previously reported that OML and MML perforant path EPSCs in mature granule cells have similar amplitudes (Woods et al., 2018) using both electrical stimulation and pathway-specific Ch2R labeling of LEC and MEC inputs. Thus the appropriate control group that we used is neurons that were not Fos-labeled, but in the same slice, and in the case of the physiology experiments they are induced by the same exact stimulus in pairs of neighboring granule cells. We think this difficult experiment is unequivocal and the best possible control. Comparing between groups of animals, some exercised and some not, is not a good experimental design given the variability between slices in placement of stimulating electrodes, and thus would not be interpretable for the purpose of this manuscript.Author response image 1Download assetOpen asset

Spine densities were similar in OML and MML of Fos-TRAPed homecage cells.(OML 3 days: 0.94 ± 0.1, MML: 0.99 ± 0.1, n=5).

– Figure 4 addresses the expression of Mtss1L in the DG in response to exercise, but the images are not very helpful. Higher magnification images are needed to illustrate the expression pattern. It is also unclear why the authors used the KOMP approach rather than the antibody shown in Figure 5A. Co-labeling of Mtss1L and Fos-TRAP before and after exercise should be obtained to confirm that it is upregulated only in Fos-TRAPed GCs.

The KOMP mice clearly show upregulation of MtsslL with exercise, which is the point of the figure. Figure 4 will be replaced, including higher magnification inserts allowing better visualization of the expression pattern in dentate granule cells. Unfortunately, none of the available antibodies against Mtss1L stain with high resolution in tissue and thus we used the galactosidase reporter expression of the KOMP mouse to examine expression in tissue. We acknowledge that this approach does not provide the cell compartment specificity that would be ideal. We are working on a KI reporter mouse but we do not think we should be required to create new antibodies or mice for this novel gene as these experiments extend beyond the scope of the manuscript and are not necessary for any of our conclusions.

– Results, fifth paragraph: Key reagent validation is necessary. The KOMP Mtss1Ltm1a(KOMP)Wtsi allele is reporter tagged allele with conditional potential. LacZ activity with this allele is not Cre dependent. LacZ activity can be eliminated with Flp expression. Treating with Cre will excise the Neo cassette and exons 7 and 8 leaving LacZ expressed and unaffected. Of concern is the lack of characterization of the allele and the apparently unnecessary manipulations on their animals (nuGFP-Cre injection). Additional controls need to be included that are required of those making or using an allele for the first time. The authors should more clearly explain the motivation for nuGFP-CRE line of experiments, as it is not clear in the text.

We agree with reviewer that LacZ activity is not Cre-dependent in the Mtss1Ltm1a(KOMP)Wtsi allele and we apologize for the misstatement that we will correct. Because the PGK promoter of the Neomycin gene is bidirectional, which may interfere with gene expression, KOMP recommends removing the Neo cassette Therefore, we did this in tissue-specific way using AAV nuGFP-Cre to remove PGK-Neo cassette in a tissue specific manner. Additional explanation will be added in the Materials and methods section of the manuscript for clarification.

We validated Mtss1L-/- KO KOMP mice using RT-qPCR (see Author response image 2A) and immunohistochemistry (see Author response image 2B) in the cerebellum. Cerebellar Purkinje cells, which have high basal firing rate, interestingly, are the only cells in the brain with high basal Mtss1L expression (see Allen Brain Atlas).Author response image 2Download assetOpen asset

Validation of Mtss1L-/- KO KOMP mice.(A) RT-qPCR data confirmed Mtss1L deletion in Mtss1L-/- KO KOMP mice in the cerebellum. Notably Mtss1L mRNA levels in the dentate gyrus were undetectable in wildtype (WT) and Mtss1L-/- KO KOMP mice. … see more

– Additionally, several sequencing and array studies suggest Mtss1L expression in neurons is ambiguous, but high in radial glia (Saarikangas et al., 2008), astrocytes (astrocyternaseq.org), oligodendrocyte progenitors (https://web.stanford.edu/group/barres_lab/brain_rnaseq.html, described in Zhang et al., 2014, J. Neurosci.). Additional experiments to better characterize Mtss1L staining would be incredibly helpful in resolving this ambiguity.

Our results are not ambiguous with respect to expression in dentate granule cells as our experiments are focused on specific populations of activated neurons; and the RNA seq results were validated by PCR and with the in vitro experiments and KOMP beta-galactosidase reporter. We agree that a better antibody would be useful, but this is not possible until we have a KI reporter as antibodies with the necessary sensitivity are not available as shown above. However, the ambiguous results the reviewer/editor mentions can be explained by the activity-dependence of MtsslL and by the lack of cell- and condition-specific conditions in these prior studies. We can discuss this point more fully in the text. Of course, Mtss1L may have a role in other cell types such as glia, but that is beyond the scope of this manuscript.

– The Mtss1L paralog Mtss1 have multiple splice variants that are biologically important controlling localization in the cell and other functions. Given the similarity one may expect similar for Mtss1L and clearly documenting the spliceform used is essential. Related, Figure 5C and D – the interpretation of these overexpression experiments will depend strongly on the spliceform of Mtss1L used. Saarikangas et al. (2015) demonstrated the Mtss1 IMD domain alone is sufficient to induce extra spines, which is almost completely identical to Mtss1L. However, Mtss1 and Mtss1L have different overexpression phenotypes, suggesting domains outside the N-terminal IMD region are biologically important. Without explaining what form of Mtss1L is being used it’s impossible for readers to determine whether these overexpression phenotypes reflect Mtss1L function, or whether a truncated form is mimicking roles established for Mtss1.

We should emphasize that the editor/reviewer is extrapolating from Mtss1, which is not the gene under study in this manuscript. The construct used for the overexpression studies was a full length Mtss1L

(https://www.ncbi.nlm.nih.gov/nuccore/BC060632.1) that includes the two known variants. The second variant differs in the 5′ UTR, lacks a portion of the 5′ coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1. The points raised about splice variants will be interesting to explore in the future, but we think the experiments are interpretable as presented. We can add to the Discussion that Mtss1 has splice variants and that this issue would be interesting to explore for Mtss1L.

– Figure 6D. The authors show that expressing Mtss1L is sufficient to alter spines in GCs in the absence of exercise, suggesting an important contribution to on-going synaptic plasticity. Thus, it seems counter-intuitive that knockdown of Mtss1L had no effect on EPSCs in the basal condition (Figure 6—figure supplement 2). This should be explained (as it relates to the first point).

We view this as the expected limitation of any over-expression experiment, particularly given that Mtss1L is not expressed in dentate granule cells in the basal condition. Thus the result is not counter-intuitive. As we show Mtss1L is not expressed at detectable levels in the absence of stimuli increasing neural activity – in our case a single bout of exercise. The value of the over-expression experiments is merely to show that Mtss1L is capable of increasing dendritic spines based on its function as an I-BAR protein. We can add to the text to make this clear.

[Editors’ notes: the authors’ response after being formally invited to submit a revised submission follows.]

Essential revisions:

The reviewers were not fully satisfied about the revision response to point 2 relating to the relationship between the authors conclusions about Mtss1L-induced synapse/spine plasticity and exercise.

There is no doubt that Fos+ cells represent an active population of GCs in the DG, sometimes referred to as “engram” cells. The Tonegawa lab has used a similar approach to show that Fos+ GCs have greater evoked EPSCs and spine density compared to Fos- GCs after a 5 min exposure to novel context (see Supplementary Figure 7 of Ryan et al., 2015). The authors should do a similar experiment – repeat the experiment of 2B in mice that have not undergone exercise – to test whether exercise is really required for this main outcome measure. The Ryan et al. data suggests that the synaptic function and spine difference between Fos+ and Fos- cells will exist in the absence of exercise (i.e. exercise is not required). The result of this experiment could differentiate whether Mtss1L is simply an activity-dependent gene downstream of Fos or whether it is specifically related to exercise-induced activity as indicated in the Abstract and Introduction. The outcome of this experiment does not change the mechanistic novelty of the role of Mtss1L in activity-dependent synaptic plasticity, but it could affect the conclusions that the authors make about this mechanism in the context of exercise. At the very least, the authors should discuss their results in the context of what has been reported about synapses/spines of Fos+ and Fos- GCs in the absence of exercise, which is very similar to what they are currently ascribing to an effect of exercise.

It is unclear how closely the synaptic changes are associated with exercise rather than then Fos-expressing status of GCs (which could occur under various conditions and in the homecage). Since the authors strongly focus on exercise and subsequent cognitive benefits in the Introduction, it is important to confirm that these are exercise-mediated effects.

The point of our experiments was to use exercise as a physiologically relevant stimulus, and the experimental design was developed to allow us to examine the time course of activation of genes following a single bout of exercise. We used this stimulus because exercise is such an important physiological stimulus and relevant to humans. It is important to make clear that we did not suggest that exercise is the only stimulus that would activate granule cells. The editor/reviewer’s comment that “whether Mtss1L is simply an activity-dependent gene downstream of Fos…” understates our results as our experiments identified Mtss1L as an activity-dependent gene and effector of synaptic reorganization. Likewise, as we demonstrated in control experiments, Fos-TRAP was used as a proxy for neuronal activity and does not necessarily imply that Mtss1L activation is molecularly coupled to Fos, although it could be. We make no claims in that regard.

With regard to the Ryan et al. (2015), the authors did not address the laminar site of spines or EPSCs or attempt to link the stimulus to specific genes. Thus direct comparison is difficult, but we have no doubt that novel experiences will activate dentate granule cells. As a control for our exercise protocol, we have previously tested the effects of introducing a fixed running wheel into the environment for 2 hours – the equivalent of a novel object. Mice explored the wheel but did not run on it. This resulted in a modest increase in Fos-TRAPed cells (ca. 2-fold, vs. 4-fold for exercise) and Mtss1L expression (3-fold compared to 9-fold, by RT-PCR). This increase was above baseline but less than observed with our exercise protocol. This data makes the point that other stimuli can upregulate Mtss1L. We have included this data as a supplementary figure, and now make it clearer in the Discussion that we are not trying to argue (nor did the original version) that exercise is the only stimulus that might activate Mtss1L – in fact we fully expect it is not.https://doi.org/10.7554/eLife.45920.026Article and author information

Author details

  1. Christina ChatziVollum Institute, Oregon Health & Science University, Portland, United StatesContribution Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editingContributed equally with Yingyu ZhangCompeting interests No competing interests declared “This ORCID iD identifies the author of this article:”0000-0001-8922-5617
  2. Yingyu ZhangVollum Institute, Oregon Health & Science University, Portland, United StatesContribution Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing—review and editingContributed equally with Christina ChatziCompeting interests No competing interests declared “This ORCID iD identifies the author of this article:”0000-0002-3414-4059
  3. Wiiliam D Hendricks
    1. Vollum Institute, Oregon Health & Science University, Portland, United States
    2. Neuroscience Graduate Program, Vollum Institute, Oregon Health & Science University, Portland, United States
    Contribution Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—review and editingCompeting interests No competing interests declared “This ORCID iD identifies the author of this article:”0000-0003-2841-577X
  4. Yang Chen
    1. Vollum Institute, Oregon Health & Science University, Portland, United States
    2. Neuroscience Graduate Program, Vollum Institute, Oregon Health & Science University, Portland, United States
    Contribution Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Writing—review and editingCompeting interests No competing interests declared “This ORCID iD identifies the author of this article:”0000-0002-4365-9900
  5. Eric Schnell
    1. Department of Anesthesiology and Perioperative Medicine, Oregon Health & Science University, Portland, United States
    2. Portland VA Health Care System, Portland, United States
    Contribution Conceptualization, Resources, Data curation, Software, Supervision, Funding acquisition, Validation, Investigation, Visualization, Writing—review and editingCompeting interests No competing interests declared “This ORCID iD identifies the author of this article:”0000-0002-5623-5015
  6. Richard H GoodmanVollum Institute, Oregon Health & Science University, Portland, United StatesContribution Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Project administration, Writing—review and editingCompeting interests No competing interests declared
  7. Gary L WestbrookVollum Institute, Oregon Health & Science University, Portland, United StatesContribution Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editingFor correspondence westbroo@ohsu.eduCompeting interests Senior editor, eLife “This ORCID iD identifies the author of this article:”0000-0002-8108-5223

Funding

National Institutes of Health (NS080979)

  • Richard H Goodman
  • Gary L Westbrook

U.S. Department of Defense (W81XWH-18-1-0598)

  • Eric Schnell

U.S. Department of Veterans Affairs (I01-BX002949)

  • Eric Schnell

Lawrence Ellison Foundation

  • Richard H Goodman

National Institutes of Health (F31-NS098597)

  • Wiiliam D Hendricks

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the following for assistance with our experiments: Stefanie Kaech Petrie, Aurelie Snyder, Crystal Shaw and the Advanced Light Microscopy Core (P30 NS061800); Shannon McWeeney and Sophia Jeng in the OHSU Bioinformatics core; Laura Villasana and Jocelyn Santiago-Perez (behavioral testing); Francesca Cargnin (electroporation); Lev Federov and OHSU transgenic core (generation of KOMP mice). This work was supported by the Ellison Foundation and NIH NS080979 (RHG and GLW), Department of Veterans Affairs Merit Review Award I01-BX002949 (ES); a Department of Defense CDMRP Award W81XWH-18-1-0598 (ES); a National Institutes of Health (NIH) Grant F31-NS098597 (WDH); and a fellowship from Ronni Lacroute (CC). The contents of this manuscript do not represent the views of the U.S. Department of Veterans Affairs or the United States government. RNA seq data generated in the manuscript have been deposited at: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA481775.

Ethics

Animal experimentation: All procedures were performed according to the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were in compliance with approved IACUC protocols at Oregon Health & Science University (protocol# TR01-IP00000148). For surgeries, all mice were anesthetized using an isoflurane delivery system (Veterinary Anesthesia Systems Co.) by spontaneous respiration and every effort was made to minimize suffering. All investigators underwent institutional Responsible Conduct & Research training.

Senior Editor

  1. Ronald L Calabrese, Emory University, United States

Reviewing Editor

  1. John Huguenard, Stanford University School of Medicine, United States

Reviewer

  1. Paul F Worley, Johns Hopkins University School of Medicine, United States

Publication history

  1. Received: February 9, 2019
  2. Accepted: June 22, 2019
  3. Accepted Manuscript published: June 24, 2019 (version 1)
  4. Version of Record published: July 4, 2019 (version 2)

Copyright

© 2019, Chatzi et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.Metrics

  • 3,506PAGE VIEWS
  • 362DOWNLOADS
  • 0CITATIONS

Page Views(Monthly)01k2k3k4k06/1907/19

Toggle charts

  1. DAILY
  2. MONTHLY

Downloads(Monthly)05010015020025030035006/1907/19

Toggle charts

  1. DAILY
  2. MONTHLY

Article citation count generated by polling the highest count across the following sources: CrossrefPubMed CentralScopus.

Download links

CATEGORIES AND TAGS

RESEARCH ORGANISM

    1. OF INTEREST
    Impact of precisely-timed inhibition of gustatory cortex on taste behavior depends on single-trial ensemble dynamicsNarendra Mukherjee et al.RESEARCH ARTICLE Updated Jul 12, 2019
  1. Further reading

FURTHER READING

    1. NEUROSCIENCE
    The perception and misperception of optical defocus, shading, and shapeScott WJ Mooney et al.RESEARCH ARTICLE Jul 12, 2019
    1. NEUROSCIENCE
    A connectional hub in the rostral anterior cingulate cortex links areas of emotion and cognitive controlWei Tang et al.RESEARCH ARTICLE Updated Jul 11, 2019

Be the first to read new articles from eLife

Sign up for alerts

Privacy noticeEmailPlease leave this field emptyReset formSign up

FIND US ON GITHUBeLife is a non-profit organisation inspired by research funders and led by scientists. Our mission is to help scientists accelerate discovery by operating a platform for research communication that encourages and recognises the most responsible behaviours in science.eLife Sciences Publications, Ltd is a limited liability non-profit non-stock corporation incorporated in the State of Delaware, USA, with company number 5030732, and is registered in the UK with company number FC030576 and branch number BR015634 at the address:eLife Sciences Publications, Ltd
Westbrook Centre, Milton Road
Cambridge CB4 1YG
UK© 2019 eLife Sciences Publications Ltd. Subject to a Creative Commons Attribution license, except where otherwise noted. ISSN: 2050-084X

StoriesNewsroom

New rapid test diagnoses pneumonia and lower respiratory infections

24 June 2019

Published in the journal Nature Biotechnology, scientists at the Quadram Institute, University of East Anglia (UEA) and Earlham Institute (EI) have developed a new, rapid way of diagnosing bacterial lower respiratory tract infections in hours rather than days that could improve patient care and slow the spread of antimicrobial resistance.

Lower respiratory infections, such as pneumonia, account for around three million deaths worldwide each year. Current diagnostic methods rely on growing bacteria from patient samples, but this takes two to three days and may still not identify the cause. 

During this time, patients are given broad-spectrum antibiotics, which may not work if the infection is caused by a resistant pathogen and could trigger side-effects. Over utilisation of broad-spectrum antibiotics is also a known driver for the development of antimicrobial resistance.

Dr Justin O’Grady and his team have successfully developed a clinical metagenomics test (genomic analysis of multiple organisms obtained from a single sample) to precisely identify the bacterial causes of lower respiratory infections within six hours. It can also determine if the pathogens are resistant to any of the antibiotics used to treat these infections.

This allows rapid treatment with targeted antibiotics, resulting in improved patient outcomes while reducing the use of broad-spectrum antibiotics and helping in the fight against antimicrobial resistance.

“Clinical metagenomics has the promise to revolutionise the diagnosis of infectious diseases, and our study describes the first rapid affordable and accurate clinical metagenomic test that could readily be used on a routine basis in a clinical setting,” said Dr O’Grady, a Group Leader at the Quadram Institute and Associate Professor at UEA.

The study overcomes some of the hurdles that have, to date, held back the widespread deployment of clinical metagenomics. The new method incorporates a step that rapidly and efficiently removes human genetic material from the sample provided by the patient, thereby leaving mainly pathogen DNA for sequencing. 

“Respiratory samples are difficult to work with because they are mainly comprised of human genetic material. Removing this makes detecting the pathogens easier and reduces the sequencing cost and time,” saidThemoula Charalampous, a researcher in the Leggett Group at EI on the study.

Dr Richard Leggett on Themoula’s supervisory team, said: “We worked with Themoula, Justin and the team on developing the bioinformatics analysis approaches used in this work. Nanopore sequencing is an extremely attractive technology for clinical diagnostics and this work is one of a number of scenarios in which we are trialling the technology at EI.”

The researchers used Oxford Nanopore’s portable MinION sequencing device to facilitate real-time sequencing, data generation and analysis. This helped reduce time-to-result from days to hours. The portability of this sequencing device means that it could be used closer to the patient, reducing the time spent sending samples to a central laboratory.

The pilot method was tested on 40 samples from patients with suspected lower respiratory infections. The team then refined the test to improve its sensitivity and reduce the time from sample to result to six hours and tested on a further 41 respiratory samples. 

“The pipeline that we’ve developed in this study produces data that can be used not only for clinical diagnostics but for public health applications such as outbreak detection and hospital infection control,” said Dr Gemma Kay.

The protocol is now being assessed in a larger multi-site clinical trial to evaluate its performance for the diagnosis of hospital-acquired pneumonia.

The new method was developed with colleagues on the Norwich Research Park, at the Norfolk and Norwich University Hospital. Funding for the study came from the Biotechnology and Biological Sciences Research Council, the Medical Research Council and the National Institute for Health Research.

Notes to editors

Nanopore metagenomics enables rapid clinical diagnosis of bacterial lower respiratory infection

Themoula Charalampous, Gemma L. Kay, Hollian Richardson, Alp Aydin, Rossella Baldan, Christopher Jeanes, Duncan Rae, Sara Grundy Daniel J. Turner, John Wain, Richard M. Leggett, David M. Livermore and Justin O’ Grady Nature Biotechnology https://www.nature.com/articles/s41587-019-0156-5

For more information, please contact:

Hayley London

Marketing & Communications Officer, Earlham Institute (EI)

  • +44 (0)1603 450 107

hayley.london@earlham.ac.ukAbout Earlham InstituteAbout Quadram Institute

Sign-up for updates.

Get the latest science, news, events, training and opportunities.Subscribe Show site mapJoin us

Contact usCookies and PrivacyTerms of useGovernancePolicy StatementsT: +44 1603 450001E: enquiries@earlham.ac.ukNorwich Research Park, Norwich, NR4 7UZ UKView mapEarlham Institute© Copyright 2019Company Registration: 06855533Charity Number: 1136213

Athena Swan
BBSCR
Greater Norwich Development Partnership
Norfolk City Council
Norfolk City Council
Norwich Research Park
South Norfolk Council

Website designed and built by Coherence

29 Comments

  1. I really like it when folks come together and share opinions.
    Great site, continue the good work! I have been surfing online more than 3 hours these days, yet I never found
    any fascinating article like yours. It’s lovely value enough for me.

    In my view, if all webmasters and bloggers made excellent content as you did, the web might be
    much more helpful than ever before. I’ve been surfing online more than three hours today, yet
    I never found any interesting article like yours.
    It’s pretty worth enough for me. In my view, if all web owners and bloggers made good content as you did,
    the internet will be a lot more useful than ever before.
    http://aoc.com/

    Like

  2. Clean the wheel wells thoroughly and free it through the
    moisture-laden particles, like leaves or dirt.

    This has increased its efficiency together interested having a
    part of any type of vehicle will surely have it using their
    company. User OEM Parts – Used car parts usually are staked in a second hand garage or a junk shop.

    Like

  3. vibrators
    Let me preface this review by saying that I had super high
    expectations for these pants. I’ve had my eye on them for about a year now,
    and have only just managed to catch them while they’re in stock.
    I snapped up all that Eden had in a size small, and one pair in a medium as well, as a gift.

    fleshlight masturbation Once in place, the ring transmits vibrations nicely to both the wearer and the receiver.
    Because the inside of the ring grips the shaft,
    it doesn’t spin around and infuriatingly move the bullet away from the receiver’s clitoris the way
    other materials do. The grip also prevents chafing, which is nice, because rubbing your scrotum raw is a real boner shrinker..
    fleshlight masturbation

    cheap fleshlight If you are one who worries about someone
    in your home or dorm hearing your vibrators
    while in use you are in the clean with Mini Metals
    it is almost whisper quiet. Being a 1 on the Buzz scale
    you won’t be able to hear it through a closed door.
    The vibrations I found to be on the buzzy numbing side of things, so if
    you are one who doesn’t like buzzy vibrations this isn’t going to be for
    you.. cheap fleshlight

    male fleshlight Keep in mind that because these are clover/butterfly clamps,
    they cannot be adjusted. That means that the second that they clamp down on the nipples, they can only
    be tightened by pulling on the attached string.
    There is no way to loosen them. The Goddess from Tantus is one of them.

    Some people say it too short, but I don think so. It has a great shape
    that stimulates my G spot very well.. male fleshlight

    cheap fleshlight I saw my little sister because she would smoke with him.
    I saw my parents because I lived with them, but not as much as
    I’d have liked. I saw two of my friends: one
    of whom he was sleeping with during our relationship
    and the other one knew and wasn’t telling me until after I had left him.
    cheap fleshlight

    fleshlight toy The young man in question is Elio (Timothe Chalamet), the 17 year
    old son of an archaeology professor (Michael Stuhlbarg) who has hired an American student named Oliver (Hammer) to
    be his assistant for the summer. As a typically self absorbed
    teenager, Elio at first seems barely aware of Oliver’s presence, being far more interested in his on and off girlfriend, reading and pursuing compositional musings on the guitar and piano.
    For his part, Oliver embodies a purely American brand of
    unbridled appetite and unselfconscious confidence
    that strikes an immediate awkward note within Elio’s casually cosmopolitan family.

    fleshlight toy

    male fleshlight I wish that it came with some and it
    wasn’t an add on purchase. The item is so well made that you’ll want the powder to get the full life span out of it.
    But in general, this is a very worthwhile purchase for
    solo or couple play if you are looking for
    a well made and discretely stored masturbator.. male fleshlight

    cheap fleshlight There were seven of them, all on cots, all barely conscious.
    The villagers had moved them into their new communal meeting hall.
    The walls and floor were bare cement. I fear that post peak/plateau oil can only dampen this impatient,
    idiotic behavior a little and may possibly even worsen it.
    Media outlets like WaPo rarely compile and analyze
    this kind of data in any meaningful way. It’s often just spotty, inconsistent, incomplete coverage with little follow up.
    cheap fleshlight

    fleshlight masturbation Grabbing onto her hips, I slammed her body down on my cock, her gasps and screams evident of pleasure.
    With each thrust, I whipped her harder and
    she begged me for more, thanked me for each hit. I could feel her cunt
    tighten around me, and I whipped her again, more forcefully, and
    she screamed.. fleshlight masturbation

    best fleshlight Going to be decided on whether or not he can defend both belts, White
    said. He can defend both and is willing to fight that much,
    anything is possible. Situation is obviously very different than what
    happened with McGregor, given that Holloway stepped in on only six
    days notice to rescue the UFC 223 main event, while McGregor actively campaigned to fight for the title in both divisions..
    best fleshlight

    fleshlight toy But it wasn happening, and I was getting frustrated.

    Everything felt awesome, and my boyfriend was doing everything right (asking me what felt good, trying lots of different things,
    being really patient and supportive, focusing on me A LOT).

    Still loved the sex, btw, just wasn having the “famed orgasm”, and was starting to
    think that it just wasn going to happen fleshlight toy.

    Like

  4. sex toys
    Sex toys rarely ever sour any sexual activity.
    If anything, it improves the experience. First of all,
    toys take you out of your comfort zone and allow you to experiment
    with different sensations. The GAO report surveyed a sampling of 15 for profit institutions and found evidence of deceptive or aggressive marketing techniques
    at every one. The targeted institutions included Westwood as well
    as Corinthian Colleges, the University of Phoenix, Education Management Corp.

    And Kaplan Higher Education, some of the industry’s biggest players.

    male fleshlight It might be fear of commitment, it might be boredom,
    it might be laziness in not wanting to work on a
    relationship, whatever. The fact is, though, that’s HIS problem.
    Two years is a long time with somebody. But, the next tale featured a man who decided to lock
    his wife and his mistress in a trunk and go for a drive.
    When he arrives at their destination, he finds the women have torn each
    other to shreds and bled out, so he dumps their bodies in a nearby pond.
    Another woman is tied naked to a statue and whipped to
    death. male fleshlight

    Male masturbator Here’s a comparison with other dildo’s in my collection as well as one between a soft drink and a water bottle.
    From left to right:Mega, One Touch, Eden strap on, and Eddie.

    I used it vaginally, and found it to be a little thicker
    than what I’m used to, but after some warming up and lube
    I was able to take some of it. I’m really sorry
    that you’re going through this, but please know that you’re not alone lots of
    women go through a yeast infection at some point and I read somewhwere that lots of women (I can’t
    remember the percentage, but it was moderate I think) will have a yeast infection at least once in their lifetime.
    Eating yogurt is a good way to keep your vulva healthy or
    to promote healthy bacteria into your system. As Heather said, you could still see your
    partner without having the kinds of sex that would make the yeast infection an issue.
    Male masturbator

    cheap sex toys President Trump listens as Senate Majority Leader Mitch
    McConnell speaks in the White House Rose Garden last month.
    According to conservative legend, Reagan’s massive first term tax cuts led to his 49 state landslide victory in 1984.
    Bush’s convention declaration “Read my lips: No new taxes” pushed him toward the White House in 1988.
    I am listening to Passionate Living: Anger and Sex (Monday,
    December 27th, 2010), and I know this is a long shot,
    but you refer to a study around the 33:50 mark, out of Arizona,
    studying the hormonal cocktail submissives receive when being flogged study.
    Monet has been a vocal and highly visible spokesperson for your sexual bill of rights since
    1991 having appeared on every major network as well as
    CNN, FOX, CNBC, WE, A and international television programs.
    Veronica has been profiled in prestigious publications including The New York Times and she has lectured at a variety of academic venues including Kent State, Stanford and Yale Universities.
    cheap sex toys

    vibrators I determined a scope of work for each option, got
    bids for each scope and totaled up the costs for each scenario, including the holding and financing costs.
    Adding a second level would cost me about $175,000 in direct renovation costs, plus it would
    take nine months to complete, which adds thousands to the holding and financing costs.

    It also comes with added opportunity costs and increases risk.
    vibrators

    cheap dildos But i told my mom the first time i ever had sex (intercourse) w/ my bf and she just made
    sure that i’m still on the pill (i don’t live w/ her) and that i’d have condoms w/ me
    at all times. Dad doesn’t know. We think he knows that i’m sexually active but
    is in denial. The silicone shaft has a tapered tip for easy
    entry and is smooth and seamless all the way around. It’s
    firm enough so that it won’t bend during penetration. With this
    handy little sling strapped on, you and your lover can experience the thrill of double
    penetration without having to involve another partner!Made
    from 100% medical grade Elite Silicone, this ultra premium dildo is body safe,
    hypoallergenic, and sculpted to excite. cheap dildos

    fleshlight toy Tucci brings similar restraint and taste for subtlety to his latest directorial effort, “Final Portrait,” which even includes a similarly wordless sequence.
    This time, the setting is the Paris studio of the sculptor and painter Alberto Giacometti as
    he and his brother Diego (Shalhoub, again) move amid the easels, rags
    and creative detritus with the reflexive, instinctive ease of ballet
    dancers embarking on a familiar pas de deux. Considered by many
    critics to be Giacometti’s last great picture, the artwork emerges slowly through the course of a film that depicts
    the creative process, not as the fully formed expression of genius, but as a slow going daily grind of
    false starts and bouts of self doubt fleshlight toy.

    Like

  5. Have you ever considered about including a little bit more
    than just your articles? I mean, what you say is valuable and all.
    Nevertheless imagine if you added some great visuals or video clips to give your posts more, “pop”!
    Your content is excellent but with images and video clips, this blog could undeniably be one of the very best
    in its field. Excellent blog!

    Like

  6. cheap vibrators
    Upon opening the clam shell packaging, there is most definitely a smell to the URCA.
    I don’t know how it compares to other UR3 products since this is
    my first toy in this material. It’s not extremely offensive, but
    it is a bit strong at first. Once they seen 1 vagina, penis, or set of testicles, they seen them all.
    There is nothing that they haven seen before and they act
    like they are just looking at any other boring part of
    the body (like the ear lol). As for pain, the first is the worst
    but it gets better.

    male fleshlight Here’s how this works. If you take the time, you’ll notice that you have four distinct stages of erection: lengthening and filling;
    swelling; full erection; rigid erection. The fourth stage, rigid erection, signifies ejaculation is close at hand.

    As a form of life coaching, this documentary is, in fact,
    kind of a dud. No wonder Bergman budgets more time for the dramatic biographies of
    a dozen of the interviewees, including her own grandmother.
    The 12 don’t exactly constitute a representative sample of Medicare eligible Americans.
    male fleshlight

    wholesale sex toys The dildo is also semi transparent, and the light passing through makes the color
    even more vibrant. The dildo did have a plastic y smell out of
    the box, but that smell mostly went away with a few washes.
    Since the toy is PVC, it can be washed either with soap and water
    or a sex toy cleaner. Second, despite probably/maybe/probably not going to have a boyfriend,
    I think I am still in love with someone else. If he’s real and he’s good,
    he’ll still be around later one. You know how in your other post I talked about the
    challenges of dating secretly and how we recommend avoiding it?
    Well, it also applies to situations like this because you can’t go to someone
    for help when something seems sketchy, and
    it’s so important to have that back up. wholesale sex toys

    fleshlight toy The next harness type is the G String or T harness.
    These are usually constructed with one strap around
    the waist, and one (or two) straps that hold the dildo in place and then slip
    between your legs and up between your cheeks, much like a thong.

    They aren’t good choices for people who have penises and balls
    to maneuver around, or who don’t like the feel of things between their cheeks; however, the
    g string is a comfortable and familiar shape for many women,
    and it’s definitely got some serious sex appeal!. fleshlight toy

    fleshlight sale The proposal would phase out the estate tax
    at the cost of $172 billion, which would almost exclusively help the wealthy.
    For $696 billion, it would eliminate the alternative minimum tax, which Congress created to ensure that loophole savvy rich people pay at
    least some federal tax. The alternative minimum tax
    compelled President Trump, for example, to pay $31 million more in taxes in 2005 than he otherwise would have, which makes
    one wonder how he would personally benefit from this unnecessary shift in the tax code.
    fleshlight sale

    male fleshlight So I looked over at him, and he whispered to me “Marry me” I know that he
    means once we both graduate high school, but he asked me to marry him.

    Now I DO love him with all of my heart and I know that we are perfect
    for each other. But Im only 14, and I could never tell my parents until after I graduated
    theyd think I was CRAZY. Alternate use for these that we
    found funny was that they fit over bulk grape jelly jars, like the kind you buy from a warehouse store.

    These look exactly like those plastic holders that keep the jelly jars together for storage.
    They also work well as a grip to open jars of pasta sauce.
    male fleshlight

    fleshlight sex toy If you are a lady, I’ll bet you cash money you will like the way your man looks in these.
    If you are a male looking to make your woman want you more, these just might do
    the trick for you. They cling to you and make your peter look bigger.
    How do we all feel about bunking off school for a sneaky holiday?
    I’m all for it, providing the children are learning lots of transferable life skills, such as falconry.
    Or gun dog training. Which is how I ended up on the phone to the eldest’s school, describing his “miserable fever”, just as the announcement
    requiring all passengers to Edinburgh to proceed to Gate 2 came
    over the speakers.. fleshlight sex toy

    cheap fleshlight Had just gotten out of rehab that she manipulated my boyfriends brother to get her out of and then she moved
    in with him and got knocked up. They got married and pregnant within a few weeks of each other (and meeting).

    Education, and not even a driver license. I felt that this
    scene didn’t have as much chemistry as the first I saw.Scene 3:The previous scene is just
    a fantasy. Back to the coffee room, and other
    “angels” come in. Xander leaves with the others, and Allie is left
    behind cheap fleshlight.

    Like

  7. wholesale nfl jerseys
    Motala, age 50, rests in the afternoon sun with the new prosthetic made for her at the Friends
    of the Asian Elephant (FAE) elephant hospital in the Mae Yao National Reserve August 29, 2011 Lampang,Thailand.

    Motala lost a foot many years back after stepping on a land mine and now is on her third prosthetic, as they need to be changed according
    to the weight of the elephant. The world’s first elephant hospital
    assists in medical care and helps to promote a better understanding of the elephant’s
    physiology, important in treating them for illness.

    cheap jerseys The dirt bike summer camps are also popular.

    Riders six years of age and older may sign up with
    a parent for dirt bike courses. Many families participate
    in these classes together.. Angulo’s extended family numbers more
    than 100 in the Bay Area, and most are undocumented. Nearly all
    the able bodied men work often, like Angulo, at two or three
    minimum wage jobs simultaneously. Few have a job with health insurance.

    cheap jerseys

    Cheap Jerseys from china You could hear him coming before you saw
    his motorcade. Escorted by police, a fleet of black SUVs and military
    vehicles pulled up and screeched to a halt. First to exit were black uniform and helmeted officers, with K’9s and M 16s.

    “Too hard” is a vague term, but basically, tight enough to compress the
    rubber, but not tight enough that the screws begin digging
    into the rubber. Your stick shouldn’t “stick” into place, and you can play with
    some confidence that your stick won’t simply destroy itself over time.
    Don’t buy this stick. Cheap Jerseys from china

    Cheap Jerseys free shipping This is a very
    important step as the rebar holds the form of the swimming pool, braces the walls, and holds back the water.

    The steel needs to be thick enough to withstand this weight and needs to be arranged in an appropriate interlocking form for the highest efficiency and
    reliability. The thickest parts of the rebar are around
    the base of pool where the walls meet the floor, around the center of the swimming pool, and around the top border
    of the swimming pool. Cheap Jerseys free shipping

    wholesale jerseys from china Question worth asking: With
    Nylander skill level through the roof, why has he taken only two shootout attempts this season?
    Jonathan Quick needed an out of body experience to stop him in Los Angeles.
    He should be used more often. Saturday night and no Leafs game.
    wholesale jerseys from china

    Cheap Jerseys from china For instance, here’s the bizarre, alien chorus being sung by
    the Earth’s magnetic field into the uncaring void of space:In 2012, NASA launched a probe that captured those recordings of the
    audible range radio waves emitted by plasma waves in the Earth’s
    magnetosphere.And now you are all space pregnant.Holy shit, that’s not a planet, that’s a
    Stanley Kubrick soundtrack. That eerie composition of heavily modified screaming voices with just the right amount of cheesy, 1950’s sci fi
    sound effects was recorded by the Cassini Huygens spacecraft.
    Cassini is a joint project between NASA, the European Space Agency and the Italian Space Agency that started detecting Saturn’s radio emissions back in 2002,
    when it was 234 million miles away from the planet. Cheap Jerseys from china

    Cheap Jerseys free shipping And so it happened. And the NHL, as
    is its custom, looked silly and ineffective. And Scott was
    in the game as captain, then out, then out of the NHL, traded from one minor league hockey town (Phoenix) to another (St.
    No quarterback drama in Denver, where Peyton Manning is playing the position about as well as
    anyone who has ever played it. Manning was 32 of 37 for 374 yards and three touchdowns, and all five incompletions were batted down or dropped by his receivers.
    It showed that the former Colt is on a different level than the rest of the league s
    top passers. Cheap Jerseys free shipping

    cheap nfl jerseys He a people person. Everyone loves him.
    He now one of 58 players on the Mets instructional league roster,
    and at 29 he also four years older than any other invitee.
    It a funny game. We took two games at their place, and we in the driver seat.
    Your thoughts are moving on to the next series.
    cheap nfl jerseys

    cheap jerseys The stories they told were of triumph and disaster.

    The BBC’s Peter Jones had the misfortune of
    commentating on English football’s greatest tragedy, the Hillsborough crush of 1989, in which 96 people died.
    The match was abandoned but he continued telling the story as it unfolded before his eyes cheap jerseys.

    Like

  8. sunsoil cbd oil cbd oil cannabidiol cbd oil cbd labs cbd oil

    cbd oil for dogs cbd oil [url=https://cbdoilnumber1.com]cbd todohemp [/url] charlotte’s web cbd oil cbd oil cbd oil texas

    Like

  9. Howdy! This is my first visit to your blog! We are a team of volunteers and starting a
    new project in a community in the same niche. Your blog provided
    us beneficial information to work on. You have done a wonderful job!

    Like

  10. I don’t even understand how I finished up here, but I believed this
    post was great. I don’t realize who you’re but certainly you’re going to a well-known blogger
    in the event you aren’t already. Cheers!

    Like

  11. Howdy! I’m at work surfing around your blog from my new iphone 3gs! Just wanted to say I love reading your blog and look forward to all your posts! Keep up the excellent work!

    Like

  12. Hey would you mind letting me know which web host you’re working with? I’ve loaded your blog in 3 completely different web browsers and I must say this blog loads a lot quicker then most. Can you recommend a good web hosting provider at a honest price? Kudos, I appreciate it!

    Like

  13. The heart of your writing while sounding reasonable originally, did not really settle well with me personally after some time. Someplace throughout the paragraphs you managed to make me a believer but just for a very short while. I nevertheless have got a problem with your leaps in logic and one might do well to help fill in those gaps. In the event that you can accomplish that, I could certainly be impressed.

    Like

  14. Howdy! Do you know if they make any plugins to
    protect against hackers? I’m kinda paranoid about losing everything
    I’ve worked hard on. Any tips?

    Like

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s