ABOUT ME, THIS BLOG, THE RESEARCHES I PARTICIPATED IN BRAZIL LIKE MY MONOGRAPH (INDUCTION OF RESISTANCE TO BENZONIDAZOLE IN HUMAN ISOLATES OF TRYPANOSOMA CRUZI) AND MY DISSERTATION [ARTICLE: THE INFLUENCE OF PHYSICAL ACTIVITY IN THE PROGRESSION OF EXPERIMENTAL LUNG CANCER IN MICE – Pathol Res Pract. 2012 Jul 15;208(7):377-81. doi: 10.1016/j.prp.2012.04.006. Epub 2012 Jun 8.] THAT I DID VERY DETAILED, INNOVATIVE AND IMPORTANT GRAPHICS ABOUT THE VARIATIONS OF ALL MICE WEIGHTS (CONTROL GROUP, AEROBIC PHYSICAL ACTIVITY – AFA GROUP AND ANAEROBIC PHYSICAL ACTIVITY – AFAN GROUP) OF DIFFERENT AGES DURING ALL EXPERIMENTAL TIME WHERE THERE WAS NO SIGNIFICANT STATISTICAL DIFFERENCE BETWEEN THEM &@ Article: Origin and Function of Stress-Induced IL-6 in Murine Models – Qing et al., 2020, Cell 182, 1-16 – July 23, 2020 © Elsevier lnc. @ YouTube Video about Gratitude that I talked because I was Invited by Internet through Direct Messages (Twitter, Facebook, LinkedIn and E-mails) to Participate as Speaker, for example, in 55 Very Important Science Events in the World in 25 Cities of Different Countries in Less than 1 year Because I Participated of Very Important Researches in Brazil. Information like images about this subject are in this Blog @ VERY IMPORTANT POSITIVE FEEDBACKS (MESSAGES – MENSAGENS) BY TWITTER FROM MY TWITTER FOLLOWER FOR ME ABOUT THIS BLOG (IMAGES ABOUT IT ARE IN THIS POST): ´´Already visited. Great material btw.´´Keep it up´´Loved the blog. Informative´´It my pleasure´´@ THE OBJECTIVE OF THIS BLOG IS ALWAYS CONTRIBUTE SIGNIFICANTLY TO THE SOCIOECONOMIC AND TECHNICAL-SCIENTIFIC DEVELOPMENT OF THE WORLD, IMPROVING THE HUMAN LIFE AND INCREASING THE HUMAN EXPECTANCY OF LIFE MORE AND MORE BY MORE EFFICIENT RESEARCHES, IDEAS, SCIENTIFIC DISCOVERIES AND PROJECTS @ ´´The Nobel Prize is widely considered the world’s most prestigious award. It is awarded for achievements in physics, chemistry, physiology or medicine, literature, peace and economics.´´ https://sweden.se/society/the-nobel-prize/ @ MANY PEOPLE NEED TO HAVE MORE MOTIVATION TO LIVE BETTER AND LONGER @ VERY IMPORTANT YOUTUBE VIDEOS, WEBSITES, SOCIAL NETWORKS, LINKS AND IMAGES OF THE WORLD @ T I M E – DATA – INFORMATION – BLOG – COUNTRIES – INTERNET – SOCIETY – DIFFERENT TECHNOLOGIES – DIFFERENT PERCEPTIONS – REALITY – DIFFERENT REALITIES – https://en.wikipedia.org/wiki/History_of_the_Internet

Do the downloads!! Share!! The diffusion of very important information and knowledge is essential for the world progress always!! Thanks!!

  • – – > > Mestrado – Dissertation – Tabelas, Figuras e Gráficos – Tables, Figures and Graphics – ´´My´´ Dissertation #Innovation #Countries #Time #Researches #Reference #Graphics #Ages #Age #Mice #People #Person #Mouse #Genetics #PersonalizedMedicine #Diagnosis #Prognosis #Treatment #Disease #UnknownDiseases #Future #VeryEfficientDrugs #VeryEfficientVaccines #VeryEfficientTherapeuticalSubstances #Tests #Laboratories #Investments #Details #HumanLongevity #DNA #Cell #Memory #Physiology #Nanomedicine #Nanotechnology #Biochemistry #NewMedicalDevices #GeneticEngineering #Internet #History #Science #World

Pathol Res Pract. 2012 Jul 15;208(7):377-81. doi: 10.1016/j.prp.2012.04.006. Epub 2012 Jun 8.

The influence of physical activity in the progression of experimental lung cancer in mice

Renato Batista Paceli 1Rodrigo Nunes CalCarlos Henrique Ferreira dos SantosJosé Antonio CordeiroCassiano Merussi NeivaKazuo Kawano NagaminePatrícia Maluf Cury


Impact_Fator-wise_Top100Science_Journals

GRUPO_AF1 – GROUP AFA1 – Aerobic Physical Activity – Atividade Física Aeróbia – ´´My´´ Dissertation – Faculty of Medicine of Sao Jose do Rio Preto

GRUPO AFAN 1 – GROUP AFAN1 – Anaerobic Physical Activity – Atividade Física Anaeróbia – ´´My´´ Dissertation – Faculty of Medicine of Sao Jose do Rio Preto

GRUPO_AF2 – GROUP AFA2 – Aerobic Physical Activity – Atividade Física Aeróbia – ´´My´´ Dissertation – Faculty of Medicine of Sao Jose do Rio Preto

GRUPO AFAN 2 – GROUP AFAN 2 – Anaerobic Physical Activity – Atividade Física Anaeróbia – ´´My´´ Dissertation – Faculty of Medicine of Sao Jose do Rio Preto

Slides – mestrado – ´´My´´ Dissertation – Faculty of Medicine of Sao Jose do Rio Preto

CARCINÓGENO DMBA EM MODELOS EXPERIMENTAIS

DMBA CARCINOGEN IN EXPERIMENTAL MODELS

Avaliação da influência da atividade física aeróbia e anaeróbia na progressão do câncer de pulmão experimental – Summary – Resumo – ´´My´´ Dissertation – Faculty of Medicine of Sao Jose do Rio Preto

https://pubmed.ncbi.nlm.nih.gov/22683274/

Abstract

Lung cancer is one of the most incident neoplasms in the world, representing the main cause of mortality for cancer. Many epidemiologic studies have suggested that physical activity may reduce the risk of lung cancer, other works evaluate the effectiveness of the use of the physical activity in the suppression, remission and reduction of the recurrence of tumors. The aim of this study was to evaluate the effects of aerobic and anaerobic physical activity in the development and the progression of lung cancer. Lung tumors were induced with a dose of 3mg of urethane/kg, in 67 male Balb – C type mice, divided in three groups: group 1_24 mice treated with urethane and without physical activity; group 2_25 mice with urethane and subjected to aerobic swimming free exercise; group 3_18 mice with urethane, subjected to anaerobic swimming exercise with gradual loading 5-20% of body weight. All the animals were sacrificed after 20 weeks, and lung lesions were analyzed. The median number of lesions (nodules and hyperplasia) was 3.0 for group 1, 2.0 for group 2 and 1.5-3 (p=0.052). When comparing only the presence or absence of lesion, there was a decrease in the number of lesions in group 3 as compared with group 1 (p=0.03) but not in relation to group 2. There were no metastases or other changes in other organs. The anaerobic physical activity, but not aerobic, diminishes the incidence of experimental lung tumors.

´´We propose to change the default P-value threshold for statistical significance from 0.05 to 0.005 for claims of new discoveries.´´ https://www.nature.com/articles/s41562-017-0189-z Published:  Daniel J. Benjamin, James O. Berger, […]Valen E. Johnson Nature Human Behaviour volume 2, pages6–10 (2018)

Um mundo além de p < 0,05 « Sandra Merlo – Fonoaudiologia da Fluência

´´My´´ Monografia – Monograph – Induction of benznidazole resistance in human Trypanosoma cruzi isolates – Indução de resistência ao benzonidazol em isolados humanos de Trypanosoma cruzi – UFTM – Federal University of Triangulo Mineiro – Uberaba 

Avaliação da influência da atividade física aeróbia e anaeróbia na progressão do câncer de pulmão experimental – Summary – Resumo

Article – ´´My´´ dissertation – Faculty of Medicine of Sao Jose do Rio Preto

Feedback positivo de pessoas sobre minha dissertação pelo Messenger – Facebook. Positive feedback of people about my dissertation, blog and YouTube channel by Facebook – Messenger. Year – Ano: 2018

LISTA DE NOMES DE PESSOAS QUE ME DERAM FEEDBACK POSITIVO SOBRE A LISTA DE EMAILS QUE FIZ EM 2015 (PROJETO) – PEOPLE´S NAMES (POSITIVE FEEDBACK ABOUT THE EMAIL LIST I DID IN 2015) – E-MAIL LIST – LISTA DE E-MAILS – PROJECT – PESQUISA -RESEARCH

My suggestion of a very important Project…

Apostila – Pubmed

A Psicossomática Psicanalítica – Faculty of Medicine of Sao Jose do Rio Preto

ÁCIDO HIALURÔNICO – HIALURONIC ACID – Faculty of Medicine of Sao Jose do Rio Preto

Slides – Mestrado final – ´´My´´ dissertation – Faculty of Medicine of Sao Jose do Rio Preto

Avaliação da influência da atividade física aeróbia e anaeróbia na progressão do câncer de pulmão experimental – Summary – Resumo

O Homem como Sujeito da Realidade da Saúde – Redação – Faculty of Medicine of Sao Jose do Rio Preto

Aula_Resultados – Results – FAMERP – Faculty of Medicine of Sao Jose do Rio Preto

As credenciais da ciência – The credentials of Science – Faculty of Medicine of Sao Jose do Rio Preto BaixarFrases que digitei – Phrases I typed

Frases que digitei – Tecnologia – Informations about blog I did

Keynote-The-Future-of-Space-Exploration(1)

2019-01-hormone-alzheimer(1)

mojap-02-00034

ajpheart.00349.2013

aging – animal models

Nanomedicine an evolving research (Opinion article I typed)

journal-of-nanomedicine–nanotechnology-flyer

Will you embrace AI fast enough

MICROBIOLOGIA – MICROBIOLOGY – Faculty of Medicine of Sao Jose do Rio Preto

Genes e Epilepsia – Genes and epilepsy – Faculty of Medicine of Sao Jose do Rio Preto

Dr.A.M.S

Flav_R03

BIOGRAFIA – BIOGRAPH – DR. DOMINGO MARCOLINO BRAILE

p-Value – Valor de p

european-respiratory-society

redefine-statistical-significance

http://www.gmail.com http://www.google.com http://www.yahoo.com http://www.forbes.com http://www.youtube.com

http://www.facebook.com http://www.instagram.com http://www.youtube.com http://www.facebook.com/scientificblog

http://www.twitter.com http://www.linkedin.com http://www.harvard.edu http://www.mit.edu http://www.stanford.edu http://www.ucla.edu http://www.columbia.edu http://www.nobelprize.org http://www.nasa.gov http://www.usa.gov http://www.wikipedia.org

http://www.wordpress.com http://www.famerp.br http://www.ita.br http://www.microsoft.com http://www.uftm.edu.br http://www.unicamp.br http://www.amazon.com http://www.alibaba.com http://www.caltech.edu http://www.science1984.wordpress.com http://www.duke.edu http://www.yale.edu http://www.cornell.edu http://www.michigan.edu

http://www.embraer.com http://www.pfizer.com http://www.cnn.com http://www.bbc.com

BRAINCOMPUTERINTERFACE

THIS IS A BLOG WITH A HUGE AMOUNT OF VERY IMPORTANT WORLD DATA STORED!

´´Compreender as grandes dificuldades de um determinado assunto pode ser um processo muito demorado, porém, de grande valia para o progresso da Ciência em todos os aspectos´´ Rodrigo Nunes Cal – 10/01/2021

´´Understanding the great difficulties of a given subject can be a very long process, however, of great value for the progress of Science in all aspects´´ Rodrigo Nunes Cal – 01/10/2021

The statistics on the number of people who visited this blog in 2018 were not entirely based on real visitors.

As estatísticas sobre número de pessoas que acessaram este blog no ano de 2018 não foram totalmente baseadas em visitantes reais.

http://www.google.com http://www.gmail.com http://www.yahoo.com http://www.forbes.com

TOP4ATOP3AATOP2AAAtop1aaaface..topblog57547

https://en.wikipedia.org/wiki/History_of_the_Interne

https://sweden.se/society/the-nobel-prize/

YouTube Channel: https://www.youtube.com/channel/UC9gsWVbGYWO04iYO2TMrP8Q

Curriculum Lattes: http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4240145A2

LinkedIn Profile: https://www.linkedin.com/in/rodrigo-nunes-cal-81433b168/

Facebook page about this blog: http://www.facebook.com/scientificblog

E-mails Acoounts: rodrigonunescal@yahoo.com rodrigoncal1984@gmail.com rodrigoncal1984@yahoo.com calrodrigonunes@gmail.com 

Twitter: @CalZole

Instagram accounts: @rodrigoncal1984 @rodrigoncal84

Gratitude: I was invited direclty throught direct messages to participate in 55 very important science events in 25 cities of different countries in less than 1 year. Informations about it are in ´´my´´ blog.

https://www.youtube.com/watch?v=mWWDMV2W7QM

https://www.coronavirus.gov/ https://www.nih.gov/coronavirus

https://www.ncbi.nlm.nih.gov/sars-cov-2/ https://pubmed.ncbi.nlm.nih.gov/22683274/

https://twitter.com/CalZole/followers https://www.manchester.ac.uk/ http://www.ita.br http://www.unicamp.br http://www.famerp.br http://www.cnpq.br/ http://lattes.cnpq.br/

http://www.facebook.com http://www.facebook.com/scientificblog http://www.twitter.com http://www.instagram.com http://www.linkedin.com http://www.youtube.com http://www.gmail.com http://www.google.com http://www.yahoo.com http://www.forbes.com

http://www.wordpress.com http://www.harvard.edu http://www.princeton.edu http://www.mit.edu http://www.caltech.edu http://www.stanford.edu http://www.ucla.edu http://www.nobelprize.org http://www.nasa.gov http://www.duke.edu http://www.yale.edu http://www.michigan.edu http://www.columbia.edu

In my dissertation I did very interesting, important, innovative and detailed graphics about variations of all mice weights (Control Group, Study Group 1 and Study Group 2) of different ages during all experimental time. It was a very innovative and important research as well my monograph (Chagas disease research -> Induction of benzonidazole resistance in human isolates of Trypanosoma cruzi). There were not statistical difference significantly among them, but the discussion of this fact is very important to the Scientific Community, conforming an article published in Nature (It’s time to talk about ditching statistical significance – Looking beyond a much used and abused measure would make science harder, but better. 20 MARCH 2019 – https://www.nature.com/articles/d41586-019-00874-8). There are posts in my blog about this very important subject for Science.

Discovering how the initial stages of certain diseases work, such as fatal diseases, is of huge importance for Science, of course. There are several biological factors connected in the human body that acting in a very complex form. Therefore, it is of great necessity to carry out new scientific researches much more detailed and modern, with high degree of precision, even if there is no significant statistical difference between certain factors. New Scientific Discoveries are essential for the world progress always. As you know, we need to have more efficient vaccines and drugs, so it is very important to do more detailed and efficient researches in mice and humans, of course. There are very important stages of development of vaccines and drugs, for sure. So, I would like so much you share this blog science1984.wordpress.com

08/08/2020

I do not earn money from this blog nor social networks. This blog content is very good with very high quality! There are a very big amount of excellent information in this blog like human health, scientific researches in humans and animal models for human diseases like cardiovascular diseases, for example. The diffusion of knowledge is essential for a country progress always!! Article of my dissertation: The influence of physical activity in the progression of experimental lung cancer in mice – Pathol Res Pract. 2012 Jul 15;208(7):377-81.

The graphics I did about the variations of all mice weights of different ages during all experimental time aren´t in the scientific article related to my dissertation nor in my dissertation as well as details about time of exercise and rest of the animals. These data can be an excellent reference for many types of researches like genetic engineering. The age of the mouse and the human being with the genetics influence in certain ways in pathophysiology in the humans and mice. So, mice researches are very important for the society as well as researches with humans. I was invited by Internet through direct messages to participate in 72 very important science events in 31 cities in less than 2 years (Auckland, Melbourne, Toronto, Edinburgh, Madrid, Suzhou, Stanbul, Miami, Singapore, Kuala Lumpur, Abu Dhabi, San Diego, Bangkok, Dublin, Sao Paulo, Dubai, Boston, Berlin, Stockholm, Prague, Valencia, Osaka, Amsterdam, Helsinki, Paris, Tokyo, Vienna, Rome, Zurich, London and Frankfurt) because I participated of very important researches. Images about it are in my blog, of course. 08/08/2020

Many people worldwide visited it and liked my blog, such as renowned professors, scientists and researchers!! So, this blog sharing is very important to the world society!! Visit and share it if possible!! More people worldwide need to know about it!! 08/08/2020

————————————————————————————————————————————-@ http://www.forbes.com

I´m graduated in Biomedicine at Federal University of Triangulo Mineiro (Uberaba – 2003-2007), I have a Master´s degree in lung cancer research in mice at Faculty of Medicine of Sao Jose do Rio Preto (2008-2012). Nowadays I work as inspector of students since 2012 in Sao Jose do Rio Preto. Maybe I can do a doctorate and PhD to work as professor, scientist and/or researcher abroad or in Brazil. (07/09/2020)

This is a blog with a lot of very important, interesting and relevant information of the world about many subjects like human health. This blog has a very big amount of very important links, websites, texts, images, photos and videos. 08/08/2020

There´re 904 posts made by me, 14,0 thousand comments approved by me and 150 followers in this blog. Note: I never earned money from blogs I did and social networkings, for example. This blog content is excellent with a very high quality! There´re many posts with so many important information! (08/11/2020)

I started to elaborate it in 2018. Many people of different countries have visited it and liked it, such as renowned researchers, professors and scientists in the world. Images about it and other subjects are available in this blog! I did it with so much dedication in a little time in relation to its big content. It was a very hard work, of course.

This is a very different blog than websites and other blogs around the World. @ 100% (3 GB) of the total data storage capacity of this blog is already used! 100% (3 GB) da capacidade total de armazenamento de dados deste blog já está utilizada!

This blog goal is contribute significantly to the technical-scientific and socio-economic development of the countries! The human expectancy of life needs to increase so much faster by more efficient researches, projects and brilliant ideas, for example!

The diffusion of great knowledge is very important to the world society. @ A difusão de ótimos conhecimentos é muito importante para a sociedade mundial.

There´re some very important facts (images) about the detailed statistics of this blog as well as other images of the total number of followers, posts and approved comments. Another note on this blog: in 2018 the statistics were not entirely real statistics. Sorry because there´re many comments that are spams. 

IT´S A VERY EASY, FAST AND PRACTICAL WAY TO KNOW EXCELLENT INFORMATION ABOUT SCIENCE, TECHNOLOGY AND INNOVATION, AS AN EXAMPLE, APPLYING THE SEARCH MECHANISM Ctrl + F IN THIS BLOG FOR A WORD OR WORDS. SO, THIS BLOG SHARING IS VERY IMPORTANT TO THE WORLD SOCIETY!

THE SCIENTIFIC COMMUNITY NEEDS TO HAVE VALUABLE INFORMATION TO IMPROVE THE WORLD FASTER MORE AND MORE! A COMUNIDADE CIENTÍFICA PRECISA TER INFORMAÇÕES VALIOSAS PARA MELHORAR O MUNDO MAIS RAPIDAMENTE CADA VEZ MAIS!

THIS IS A BLOG WITH A HUGE AMOUNT OF VERY IMPORTANT WORLD STORED DATA. @ O IMPOSSÍVEL PODE SER POSSÍVEL. THE IMPOSSIBLE CAN BE POSSIBLE. @ ´´EVERYONE DIES. THE GOAL IS NOT TO LIVE FOREVER. THE GOAL IS TO CREATE SOMETHING THAT WILL´´

ESTE É UM BLOG COM UMA ENORME QUANTIDADE DE DADOS MUNDIAIS MUITO IMPORTANTES ARMAZENADOS. RECEBI MUITOS FEEDBACKS POSITIVOS SOBRE ESTE BLOG POR MEIO DO TWITTER, FACEBOOK, LINKEDIN E E-MAILS, TAIS COMO DE RENOMADOS PROFESSORES, CIENTISTAS E PESQUISADORES DO MUNDO, POR EXEMPLO.

The researches I participated in Brazil made at Federal University of Triangulo Mineiro – Uberaba city (Graduation: 2003-2007) and Faculty of Medicine of Sao Jose do Rio Preto [´´My´´ Monograph: Induction of benzonidazole resistance in human isolates of Trypanosoma cruzi and ´´my´´ Dissertation: The influence of physical activity in the progression of experimental lung cancer in mice – Pathol Res Pract. 2012 Jul 15;208(7):377-81] can help in anyway the work of researchers, professors, scientists, students and other people interested in scientific researches as an excellent references for future researches of many types in humans and mice.

I have received many positive feedbacks about this Blog by Facebook, Twitter, E-mails and LinkedIn for example, such as from renowned professors, scientists and researchers in the world. These data are in this blog as well as the direct invitations I have received to participate in very important scientific events worldwide.

In less than 2 years I was invited by Internet through direct messages to participate in 77 very important scientific events in 32 cities in different countries (Hong Kong, Auckland, Melbourne, Toronto, Edinburgh, Madrid, Suzhou, Stanbul, Miami, Singapore, Kuala Lumpur, Abu Dhabi, San Diego, Bangkok, Dublin, Sao Paulo, Dubai, Boston, Berlin, Stockholm, Prague, Valencia, Osaka, Amsterdam, Helsinki, Paris, Tokyo, Vienna, Rome, Zurich, London and Frankfurt) because I participated of very innovative and important researches in Brazil like ´´my´´ dissertation [lung cancer research in mice – The influence of physical activity in the progression of experimental lung cancer in mice. Pathol Res Pract.  2012 Jul 15;208(7):377-81] and ´´my´´ monograph (Chagas disease research in laboratory at Federal University of Triangulo Mineiro – Uberaba city). There are very important and interesting data in this blog, like images about this subject and on animal models for human diseases, such as cardiovascular diseases. 

Science events and researches are essential for the world progress in all aspects. Unfortunately there´re fatal diseases without cure or total prevention methods like vaccination. Drugs are very important to the human health, of course! Therefore, new scientific discoveries need to emerge urgently to people live better and longer more and more in the world! 

I was invited by Twitter to participate in Science Advisory Board – an online community of scientific and medical professionals from all around the world.

NOVAS DESCOBERTAS CIENTÍFICAS PRECISAM SURGIR URGENTEMENTE NO MUNDO PARA AS PESSOAS VIVEREM BEM MELHOR, COM MAIS QUALIDADE DE VIDA, E POR MUITO MAIS TEMPO, CADA VEZ MAIS.

DISCOVERING HOW THE INITIAL STAGES OF CERTAIN DISEASES WORK, SUCH AS A FATAL DISEASES, IS OF HUGE IMPORTANCE FOR SCIENCE, FOR SURE. THERE ARE SEVERAL BIOLOGICAL FACTORS CONNECTED IN THE HUMAN BODY THAT ACTING IN A VERY COMPLEX FORM. THEREFORE, IT IS OF GREAT NECESSITY TO CARRY OUT NEW SCIENTIFIC RESEARCHES MUCH MORE DETAILED AND MODERN, WITH A HIGH DEGREE OF PRECISION, EVEN IF THERE IS NO SIGNIFICANT STATISTICAL DIFFERENCE BETWEEN CERTAIN FACTORS.

DESCOBRIR COMO FUNCIONA OS ESTÁGIOS INICIAIS DE DETERMINADAS DOENÇAS, TAIS COMO DE DOENÇA FATAIS, É DE ENORME IMPORTÂNCIA PARA A CIÊNCIA, COM TODA CERTEZA. HÁ VÁRIOS FATORES BIOLÓGICOS INTERLIGADOS NO CORPO HUMANO QUE ATUAM DE FORMA MUITO COMPLEXA. PORTANTO, É DE GRANDE NECESSIDADE A REALIZAÇÃO DE NOVAS PESQUISAS CIENTÍFICAS MUITO MAIS MINUCIOSAS E MODERNAS, COM ALTO GRAU DE PRECISÃO, MESMO QUE NÃO HAJA DIFERENÇA ESTATÍSTICA SIGNIFICATIVA ENTRE DETERMINADOS FATORES.

100% of the total data storage capacity of this blog is already used
100% da capacidade total de armazenamento de dados deste blog já está utilizada

´´NÃO VÁ PARA ONDE O CAMINHO PODE TE LEVAR. VÁ ONDE NÃO HÁ CAMINHO E DEIXE UMA TRILHA. ´´ &@´´DON’T GO WHERE THE PATH CAN TAKE YOU. GO WHERE THERE IS NO PATH AND LEAVE A TRAIL. ´´ @ CONHECENDO O DESCONHECIDO.. @ KNOWING THE UNKNOWN..

It is obvious that the virtual is not the same as the real because there are some or many differences and peculiarities of each situation. É óbvio que o virtual não é igual ao real porque há algumas ou muitas diferenças e particularidades próprias de cada situação.

Each person has their own way of thinking and acting, for sure. Cada pessoa tem a sua própria maneira de pensar e agir, com certeza. The world we live is very interdependent, for sure.

Reconhecer o(s) erro(s) cometido(s) e não praticá-lo(s) novamente é um ato de grande sabedoria e importância para si mesmo e para outra(s) pessoa(s). É claro que existem vários tipos de erros.

Acknowledging mistakes and not doing them again is an act of great wisdom and importance for yourself and to the other person or people. There are many types of mistakes, of course.

Esta imagem possuí um atributo alt vazio; O nome do arquivo é face31x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face76xzx-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face1x-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face2-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face2x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face3-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face3x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face4ss-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face7-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face8x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face9x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face21x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face31x-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face43x-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face76xzx-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face77x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face87-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face334-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face7575-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face645643-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face757547-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face867869-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face8548568-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face9785679-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face75758567-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face76657568-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face645645846-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face75675685468-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é linkedin5344-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é linkedin63546354-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é linkedin64356543-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é linkedin7457575575-2.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é face43x-1.jpg
Esta imagem possuí um atributo alt vazio; O nome do arquivo é linkedin75474575.jpg

2wtwitter

2aaaa

3wwitter

1wtwitter

4wtwitter

In relation to ´´my´´ dissertation, I made very detailed, interesting and important graphics about the variations in all weights of all mice of different ages in the Control Group, Group 1 and Group 2 during all experimental time. Without a doubt, it was a very innovative and important research for the world scientific community as well as ´´my´´ monograph.  

* Link about my monograph: Induction of benzonidazole resistance in human isolates of Trypanosoma cruzi: 

https://science1984.wordpress.com/2018/07/15/my-monography-chagas-disease-research-in-laboratory-2/

https://science1984.wordpress.com/2019/05/08/21809/

-Links about animal model for human diseases like cardiovascular diseases: 

https://science1984.wordpress.com/2020/04/29/33426/

https://science1984.wordpress.com/2020/04/29/the-good-thing-about-science-is-that-its-true-whether-you-believe-in-it-or-not/

– Links related with ´´my´´ dissertation: 

https://science1984.wordpress.com/2019/11/28/links-of-my-dissertation-the-influence-of-physical-activity-in-the-progression-of-experimental-lung-cancer-in-mice-and-monograph-induction-of-benzonidazole-resistance-in-human-isolates-of-trypanoso/

https://science1984.wordpress.com/2019/11/29/about-my-dissertation-the-influence-of-physical-activity-in-the-progression-of-experimental-lung-cancer-in-mice-pathol-res-pract-2012-jul-152087377-81-doi-10-1016-j-prp-2012-04-006-epub-20/

https://science1984.wordpress.com/2018/07/15/i-did-very-important-detailed-and-innovative-graphics-about-variations-of-all-mice-weigths-during-all-exerimental-time-my-dissertation-they-can-be-an-excelent-reference-for-future-researches-like-2/

https://science1984.wordpress.com/2019/03/08/it-is-fundamental-professors-students-researchers-and-other-people-worldwide-know-about-my-dissertation-because-the-research-was-very-innovative-and-important-in-the-world-these-data-like-graphics/

https://science1984.wordpress.com/2019/05/08/21809/

It´s very important professors, scientists, students, researchers and other people worldwide know about ´´my´´ dissertation made at Faculty of Medicine of Sao Jose do Rio Preto because it was a very innovative and important research as well as ´´my´´ monograph. They are related to very relevant subjects.

The data like very detailed, interesting and important graphics I made about variations of weights in all mice of different ages (Control Group -> treated with urethane and without physical activity and Study Groups – Aerobic Group -> treated with urethane and subjected to aerobic swimming free exercise – Anaerobic Group –> treated with urethane and subjected to anaerobic swimming exercise with gradual loading 5-20% of body weight) during all experimental time [My dissertation -> Lung cancer research in mice – Article: The influence of physical activity in the progression of experimental lung cancer in mice – Pathol Res Pract. 2012 Jul 15;208(7):377-81] are very important for the world scientific community.

These graphics I did related to my dissertation aren´t in the article nor in ´´my´´ dissertation as well as details about time of exercise and rest of the animals. They can be an excellent reference for many types of researches in mice and humans, like in the field of genetic engineering. The discussion of certain facts in science envolving stastistics is fundamental to the scientific community, for example, the analysis and interpretation of very important, innovative and interesting graphics with no statistical difference between them can have a big value to the analysis of researches and to the future researches. So, the quality and efficiency of researches can increase so much in a little time, increasing the possiblities of excellent references and new scientific discoveries to the world. The facts veracity and the disclosure of them are essential for the scientific community, of course. Links about this subject: 

https://science1984.wordpress.com/2020/04/28/alfred-nobel-had-a-vision-of-a-better-world-he-believed-that-people-are-capable-of-helping-to-improve-society-through-knowledge-science-and-humanism-this-is-why-he-created-a-prize-that/

https://science1984.wordpress.com/2020/03/19/editorial-20-march-2019-its-time-to-talk-about-ditching-statistical-significance-looking-beyond-a-much-used-and-abused-measure-would-make-science-harder-but-better-nature-567-283-201/

https://science1984.wordpress.com/2020/03/19/nao-houve-diferenca-estatistica-significativa-e-agora-a-frase-nao-houve-diferenca-estatistica-significativa-soa-quase-como-uma-sentenca-de-morte-para-muitos-alunos-de-g/

The age of the human, of the animal like mouse and the genetics influence in certain ways in the pathophysiology and in other aspects in the humans and mice. This subject is not easy to understand, of course. So, mice researches are essential for the world society as well as human researches. More informations about it are in these links: 

https://science1984.wordpress.com/2018/07/15/i-did-very-important-detailed-and-innovative-graphics-about-variations-of-all-mice-weigths-during-all-exerimental-time-my-dissertation-they-can-be-an-excelent-reference-for-future-researches-like-2/

https://science1984.wordpress.com/2020/03/27/32357/

https://science1984.wordpress.com/2020/03/27/eara-european-animal-research-association-supports-call-to-end-embargo-by-transport-providers-in-the-uk-and-us-on-animal-research-transplant-method-avoids-rejection-of-donor-leg-for-months-in-rats/

https://science1984.wordpress.com/2020/04/02/european-animal-research-association-mice-play-an-essential-role-in-both-vaccine-and-drug-development-for-covid-19-ordinary-mice-are-not-susceptible-to-the-disease-so-scientists-breed-genetica/

*Very important observations:

  1. Cancer is very related to the weight loss of the patient. Weight loss of the patient is very associated with cancer – The syndrome of Anorexia-Cachexia (SAC) is a frequent complication in patients with advanced malignant neoplasia.
  2. Age, weight and genetics of the person are very important factors that influence cancer in a determined ways.
  3. The genetics of the mouse is very similar to that of the human.
  4. Maintaining proper body weight is one of the main ways to prevent cancer of a person.
  5. Animal testing has a very high importance to world society.
  6. The mouse is the main animal model used as the basis for research on diseases that affect humans.
  7. Weight lifting (bodybuilder) is a very good example of anaerobic physical activity in humans.

In ´´my´´ dissertation the progression of lung cancer was lower in the group of mice that practiced anaerobic physical activity. It would be very important, innovative and interesting to do researches in mice and humans testing a substance or substances and analyzing biochemical, pathological, pharmacological and physiological factors like weights in all experimental time and the influence of age and genetics within the group itself and in the other groups in the inhibition and/or progression of a determined disease like cancer. In this context, it´s very important to seek new methodologies for the treatment, prevention and early detection of cancer and/or other diseases, such as vaccines and other very modern and efficient technologies. It is clear that the correct and accurate study of cancer (as an example, the conduct of scientific researches) and certain diseases, is very complicated to be performed because they´re very complex diseases that are difficult to understand.

Note about ´´my´´ dissertartion: during anaerobic exercise it was necessary to briefly hold the tail of the mice for better physical performance and better adaptation to the submitted environment. In this same type of exercise, there were times when the mice could not exercise and sank, causing manual manipulation again. The physical wear of the animals was very intense.

It´s very important to consider the significance of variants of weight, age and genetics em relation to cancer. It is not easy understand it, of course. Therefore, more researches about it are very necessary in the world.

I hope that researchers, teachers, students, scientists and other people linked to scientific researches worldwide use the graphics I made about the variations of all mice weights during all experimental time of ´´my´´ dissertation as an example, model or reference for conducting future scientific researches as well as other data from ´´my´´ monograph and dissertation, leading to a very beneficial innovation in the researches methodologies bringing very relevant results to the world society, significantly increasing the human life time more and more.

Many laboratories have been researching mice for a long time, even resulting in excellent prizes for researchers such as the Nobel Prize. For example, the Jackson Laboratory. The world needs to have more very good and efficient ideas and scientific discoveries for human live longer faster more and more. 

Many people think they have made mistakes but in fact they have not made mistakes. Many people think they did the right thing but they did not. The important thing is to reflect on this in order to better know the origin of your thoughts and your thoughts, acting accordingly in the best way for the good of you and other people.

Muitos acham que erraram mas na verdade não erraram. Muitos acham que acertaram mas não acertaram. O importante é refletir sobre isso para conhecer melhor a origem de seus pensamentos e seus pensamentos em si, agindo consequentemente da melhor forma para o bem de si e da(s) outra(s) pessoa(s).

Rodrigo Nunes Cal’s research works  

Rodrigo Nunes Cal’s research works

Rodrigo Nunes Cal’s 1 research works with 12 citations and 137 reads, including: The influence of physical activ…

I hope collaborate significantly with these information in the world scientific progress always!

The world needs to improve so much in the best ways.

Many people worldwide need to have more motivation to live better and longer, of course.

————————————————————————————————————————@

5aaaa543aaaa

TWITTER8ATWITTER4AAAATWITTER4ATWITTER1APEFILTWITTER6565TWTERRTRUMPtwitter68568568567 - CopiaTWITTER8657856Sem título546654aaaFACEFACE2333FACE856856856FACE76574585FACE8678679FACE86856face4555Sem título546654aaaFACEtwitter767686twitter087078078twitter87686856twitter656586896twitter765856856twitter76978twitter75754twitter6686796twitter86856856twitter4455TWITTER6888TWITTER65574TWITTER887TWITTER767Sem título56tyt5656Sem título546654aaaFACEtwiter85768678567twitter0000000000twitter88twiter868569twiter765856twiter74575twitter0809twitter688twitter885perfil1zzperfil4zzzSem título56tyt5656pefil2zzz3zzzzz2zzzz1zzzperfil6zzz756745ccc1a23aagraphics8ww7www5wwsiteIEEE1wwww2wwww3wwwSem títuloeu----


7777777i

posts55555555

4444444444444444444444444444tryy

2wwwwww1wwwwwww

4444444444444444444444aaaaaaaaaaaaaaa444444444444444444444444444444444444

4444444444444444444sxxxx444444444444444444444jfgjj44444444444444444HFGHFGJ4444444444rtjgfj

Sem títuloTOP1111Sem títuloXXXXXsssssstop0000top9869679XXXXXXXYYY5ttttt6ttt9ttt78776786uuuu845685854aa4444444444rtjgfj44444444444aaaaaagfg444444444444aaaaa444444444444fgjgjj444444444444hhhh4444444444444aaassasa4444444444444dddd4444444444444jgjgffgj4444444444444rttt44444444444444klj44444444444444opp44444444444444rtt44444444444444wee44444444444444yuuu444444444444444ttu4444444444444444uoioo4444444444444444yiy44444444444444444assas44444444444444444ffff444444444444444444yuyuyi44444444444444444444bbbb44444444444444444444tyyy444444444444444444444jfgjj4444444444444444444444aaaaaaaaaaaaaaa4444444444444444444444444444tryy4444444444444444444444444444444444444444444444444444444ffff4444444444444444444iuyoy4444444444444444444sxxxx4444444444444444444utyurtyttyMARK--64537534COMMENTSem título444444444444444444444444jrjkjkSem títuloeu----Sem títuloperifl55

https://www.nutraingredients.com/Article/2020/02/17/Poop-eating-lab-mice-affect-probiotic-research-outcomes-says-study?fbclid=IwAR268flQNlmSgIoVdovQ8H4aMwXd9GbzhSXvDlAQ7TDDk-S7ZGRx8mXYLeQ

New Research Reveals Compound That Eliminates Chronic Pain in Mice; Promising Development for Medicine

Apr 30, 2020 11:52 PM EDT

https://www.sciencetimes.com/articles/25539/20200430/new-research-reveals-compound-eliminates-chronic-pain-mice-promising-development.htm?fbclid=IwAR3EJPB3GO0vIMb3tA_1px1S8mzRY16lGxJXlveJk7D3f1IaeuhTH4RGLD4

NEWS

Artificial intelligence decodes the facial expressions of mice

Neuroscientists also uncover neural circuitry whose activity correlates with particular emotions.

https://www.nature.com/articles/d41586-020-01002-7?fbclid=IwAR36qn4ZIol36sfYzK2X1ycH_lilERWl6VAfiGW4-9XGIwXSTjAPXP1GfC0

http://www.google.com http://www.gmail.com http://www.yahoo.com http://www.forbes.com http://www.nobelprize.org http://www.wikipedia.org http://www.nasa.gov http://www.harvard.edu

http://www.stanford.edu http://www.ucla.edu http://www.mit.edu http://www.youtube.com

Study suggests effective fat-reducing therapy

The approach may lead to a new treatment approach for osteoarthritis, obesity.

https://www.techexplorist.com/effective-fat-reducing-therapy/32177/?fbclid=IwAR3gi4Yv4FD-Fqo-_H7xltAYMPfiOwy4LKnqmGxoEjxAS4Fm48mqD3CJbHE

http://www.yale.edu http://www.cnn.com http://www.bbc.com

New Study Suggests Ways to Alleviate Social Withdrawal Symptoms in Mental Illnesses

UC Davis Study in Mice Shows That Pharmacology Can Block Brain Pathways Altered by Stress

By Karen Nikos-Rose on April 27, 2020 in Science & Technology

https://www.ucdavis.edu/news/new-study-suggests-ways-alleviate-social-withdrawal-symptoms-mental-illnesses/?fbclid=IwAR0_lPNI5QO_grbf5W6iS4Z9ui0NWsee6AkF_X2C8mRgdAVo09d9QjtrLZU

Gene Expression Profiling and Bioinformatics Solutions

https://teletype.in/@alice.larter/E3APk5IQv?fbclid=IwAR24tGiAl89CFu9iHYw9ThZSA5Z_woE5qzeY7B2aZ57aIEIpxJK5wlbUN54

http://www.wordpress.com http://www.instagram.com http://www.facebook.com

The Cancer Researcher is an online magazine for the cancer research community from the European Association for Cancer Research. http://magazine.eacr.org/tag/mental-health-series/

http://www.twitter.com http://www.columbia.edu http://www.science1984.wordpress.com

http://www.michigan.edu http://www.caltech.edu http://www.cornell.edu

http://www.famerp.br http://www.unicamp.br http://www.ita.br

https://www.cell.com/cell/fulltext/S0092-8674(20)30687-5

Assistant Professor – andrew.wang@yale.edu https://medicine.yale.edu/profile/andrew_wang/

https://www.cell.com/cell/home

https://www.cell.com/cell/fulltext/S0092-8674(20)30687-5

https://www.cell.com/action/showPdf?pii=S0092-8674%2820%2930687-5

http://sciencemission.com/site/index.php?page=news&type=view&id=health-science%2Fhow-stress-causes&filter=8%2C9%2C10%2C11%2C12%2C13%2C14%2C16%2C17%2C18%2C19%2C20%2C27&fbclid=IwAR0ejTDh2KJiaG5kqyqZvSfm6cfX0uvsWW1ObYk9jE3z2fxhxiGEOVfSxgE

http://sciencemission.com/site/index.php?page=news&type=view&id=publications%2Forigin-and-function-of&filter=22

https://en.wikipedia.org/wiki/Elsevier

https://news.yale.edu/2020/06/30/fat-check-researchers-find-explanation-stress-damage-brown-fat

https://pt.wikipedia.org/wiki/Elsevier

https://wordpress.com/post/science1984.wordpress.com/35114

New way to see RNA could help fight pathogens

https://phys.org/news/2020-07-rna-pathogens.html?utm_source=dlvr.it&utm_medium=facebook

https://www.youtube.com/watch?v=mWWDMV2W7QM

https://www.youtube.com/watch?v=N4H7M2Rtvtk&feature=youtu.be&fbclid=IwAR1LHCL0Tv3Mfa4NizDg9i7PCGvw1rnNCD6frU6D88znK4FiQnxwfTYMTAc

https://www.youtube.com/watch?v=Wq7GWKPuzPo&feature=share&fbclid=IwAR26x05pd-zSi5tbSpIkhwhdQBfClWGLtvSUYywPgttRKLy68typX5n2X-Q

https://www.youtube.com/watch?v=xdu56Ir-dlg&fbclid=IwAR17SmGg9kAAYFY7rXTuTSsviTOik5MjPFW4iZP7oDWwAKk-diK_MoCRKEk

https://www.youtube.com/watch?v=U8fme1boEbE

https://www.youtube.com/watch?v=f6KyEhHyLeQ

https://www.youtube.com/watch?v=P1FYk1lkdh4&list=PLiuUQ9asub3Q42pen-u0C7miMRjPGVhGx

https://www.youtube.com/watch?v=e0uydNe4cQo

https://www.youtube.com/watch?v=_zuO3oEmZn4

https://www.youtube.com/watch?v=MiNAZf3mq9U

https://www.youtube.com/watch?v=vAxPDoG8JYM

https://www.youtube.com/watch?v=xDeAc4T-nls

https://www.youtube.com/watch?v=uMfvk9klzG0

https://www.youtube.com/watch?v=2hxUMpYFo_Y

https://www.youtube.com/watch?v=6c_PHj3ZJEA

https://www.youtube.com/watch?v=6RL_KZ2bAQE

https://www.youtube.com/watch?v=iA_FfVuTfoM

https://www.youtube.com/watch?v=bncXrmnni_E

77777uuu

5ttttt6ttt78BOMBONERA...BOMBONERA..45BOMBONERA45NATIONAL ACADEMY SCIENCE...646NATIONAL ACADEMY SCIENCE..NATIONAL ACADEMY SCIENCESem títuloperifl55
Cell
ARTICLE|ONLINE NOW

Origin and Function of Stress-Induced IL-6 in Murine Models

Origin and Function of Stress-Induced IL-6 in Murine Models

Highlights

  • IL-6 is the dominant endocrine cytokine induced by acute stress in mice
  • Stress-inducible IL-6 is produced in brown adipocytes via ADRB3 signaling
  • IL-6 is required for stress hyperglycemia and adaptive “fight or flight” responses
  • Stress-induced IL-6 decreases tolerance to a subsequent inflammatory challenge

Summary

Acute psychological stress has long been known to decrease host fitness to inflammation in a wide variety of diseases, but how this occurs is incompletely understood. Using mouse models, we show that interleukin-6 (IL-6) is the dominant cytokine inducible upon acute stress alone. Stress-inducible IL-6 is produced from brown adipocytes in a beta-3-adrenergic-receptor-dependent fashion. During stress, endocrine IL-6 is the required instructive signal for mediating hyperglycemia through hepatic gluconeogenesis, which is necessary for anticipating and fueling “fight or flight” responses. This adaptation comes at the cost of enhancing mortality to a subsequent inflammatory challenge. These findings provide a mechanistic understanding of the ontogeny and adaptive purpose of IL-6 as a bona fide stress hormone coordinating systemic immunometabolic reprogramming. This brain-brown fat-liver axis might provide new insights into brown adipose tissue as a stress-responsive endocrine organ and mechanistic insight into targeting this axis in the treatment of inflammatory and neuropsychiatric diseases.

Graphical Abstract

Keywords

Introduction

Acute life stressors have been observed to decompensate a wide range of inflammatory diseases since antiquity (

;

). Most chronic sterile inflammatory diseases are known to “flare” after acute stress, contributing significantly to morbidity and mortality. Indeed, psychosocial stress worsens most inflammatory diseases, including allergic diseases, autoimmune diseases, and cancers (

;

;

;

). In human studies, stress induces measurable changes in biology, such as in the magnitude of inflammatory cytokines and in functional changes within relevant end-organs, such as in pulmonary function in the case of allergic inflammation (

). Concordantly, several randomized controlled trials targeting stress management have largely lead to improvement in the morbidity of inflammatory diseases (

;

;

). However, the well-studied mediators of stress physiology, glucocorticoids, and catecholamines, are primarily thought to be immunosuppressive (

) and used therapeutically for this purpose, creating a paradox that many have tried to resolve for over 30 years (

;

). How does psychological stress, which leads to the production of immunosuppressive mediators such as cortisol and catecholamines, decrease host fitness to inflammation?

Studies dating back to 1990 have shown that psychological stress increases circulating levels of interleukin-6 (IL-6) in humans and laboratory animals (

;

;

). The role that IL-6 plays in the acute stress response, also referred to as the “fight or flight” response, is unclear. The idea that stress itself induces endocrine mediators like IL-6, which is traditionally associated with inflammation, has since been supported by the detection of increased circulating cytokines in depression and anxiety (

;

) and by the association of IL-6 polymorphisms in individuals with depression (

). Moreover, there is a robust relationship between depression and anxiety and poor outcomes in inflammatory diseases (

;

). This body of research has led to clinical trials assessing the efficacy of an antagonizing monoclonal antibody targeting IL-6 receptor subunit alpha (IL-6Ra), tocilizumab—used in rheumatoid arthritis and vasculitis—in depression (

), despite little understanding of how and why stress induces IL-6. The possibility that stress-inducible cytokines, as opposed to glucocorticoids or catecholamines, underlie how stress leads to poorer outcomes in inflammatory diseases has not been explored in depth.

Here, we report that commonly utilized models of acute stress in mice induce endocrine IL-6. Stress-induced IL-6 requires consciousness and beta-3-adrenergic-receptor signaling in brown adipocytes. IL-6 is required for stress hyperglycemia, a metabolic adaptation that enables the “fight or flight” response, via hepatic gluconeogenesis. The cost of stress-induced IL-6 is that it decreases host fitness to a subsequent inflammatory challenge. Our studies therefore mechanistically uncover the origin and adaptive function of IL-6 in acute stress and its cost in the setting of inflammation in mice.

Results

 Acute stress induces endocrine IL-6

We found that standard laboratory models of acute stress—including tube restraint, cage switching, and social isolation—induced high levels of circulating IL-6 (Figure 1A), consistent with previous studies demonstrating that stress alone induced IL-6 (

;

;

). Unexpectedly, we found that a single, conscious, retro-orbital bleed induced IL-6 (Figure 1A). To more comprehensively survey other stress-inducible immune mediators, we screened 32 inflammatory cytokines and chemokines in the circulation of stressed mice and identified a set of cytokines inducible by stress alone; IL-6 was the most greatly induced cytokine and common to two different stress models (Figure 1B). We did not detect corresponding increases in the soluble IL-6 receptor (Figure S1A) (

). The absolute level of IL-6 we detected fell in the middle range of reported levels (50 pg/mL to 200 ng/mL) in inflammatory contexts and above reported ranges post-exercise and in diet-induced obesity (30–100 pg/mL) (

;

;

;

;

;

;

;

;

). We also confirmed that acute, stress-increased IL-6 was independent of handlers (as indicated Figure 1A–C).

Figure thumbnail figs1

Figure S1ADRB3 Mediates Brown Adipocyte-Derived IL-6 in Response to Acute Stress, Related to , and 
To exclude circadian oscillations leading to fluctuations in IL-6, we measured circulating IL-6 over time by retro-orbital bleeding and observed that repeated bleeding of the same animals sustained high IL-6 levels. When individual cages of unmanipulated, entrained animals were bled at the corresponding Zeitgeber times (five mice per ZT time, bled only once at that ZT time), no such sustained increase in IL-6 was noted, demonstrating that conscious bleeding itself increased circulating IL-6 and that repeated bleeding sustained high IL-6 levels (Figure 1C). Thus, in order to gain insight into the kinetics of IL-6 after an acute stress, we subjected several groups of mice to a single retro-orbital bleed, and then sampled individual groups at different time points after the bleed. Circulatory cortisol and noradrenaline were increased within 15 min, peaked at 2 h after acute stress, and returned to baseline by 4 h; however, IL-6, which was significantly increased in blood by 2 h, peaked at 4 h, and was even detectable above baseline 18 h after acute stress (Figure 1D). The unique kinetics of stress-induced endocrine IL-6 suggested that it may be mediating more sustained aspects of stress physiology.

Because the adrenal gland is thought to be the major mediator of the acute stress response, and previous reports have described adrenally derived IL-6 (

), we asked if the adrenal gland was required for stress-induced IL-6. We found that adrenalectomized mice had significantly higher levels of IL-6 after stress, suggesting that the adrenal gland negatively regulated IL-6 (Figure S1B). To address previous reports of cross-talk between IL-6 and adrenal hormones (

;

), we utilized an antagonistic anti-IL-6Ra antibody and found that inhibition of IL-6 signaling did not change circulating levels of corticosterone or noradrenaline after acute stress (Figures S1C and S1D). This model avoids the confounding developmental defects observed in constitutive IL-6 knockout animals (

).

We then validated previous observations that circulating IL-6 levels were increased in stressed humans (

;

). We acquired a community sample of individuals that were carefully assessed for high and low stress by using a structured cumulative stress and adversity interview that assessed recent and past life events (Cumulative Adversity Interview) (

;

;

). The high and low groups were group matched by age, gender, education, and body mass index (Figure S1E). We found significant overall increased IL-6 levels in the high (74 pg/mL, SE: 35) versus low (3.9 pg/mL, SE: 2.78) stress groups (t = 2.15, p < 0.05) (Figure S1E). The absolute circulating level of stress-associated IL-6 in humans was a hundred times lower in mice, reflecting inter-species variation and/or acuity, heterogeneity, and magnitude of stressors. Taken together, these data indicate that IL-6 is an endocrine hormone inducible by acute stress alone, with different kinetics than the canonical stress hormones, corticosterone and noradrenaline.

 Stress-inducible IL-6 is produced by brown adipocytes

To understand the ontogeny of stress-induced IL-6, we first ensured that IL-6 was not induced by retro-orbital bleeding as a result of bacterial translocation from the skin or gastrointestinal tract (

). Consistent with our observations that other acute-phase cytokines were not induced after stress, stress-induced IL-6 was present in both gnotobiotic animals and animals deficient in key signaling pathways necessary for detecting bacteria (Figure 2A). Previous reports had suggested that hyperglycemia itself, a characteristic feature of the acute stress response (

), was sufficient to induce IL-6. To test this, we performed an oral glucose tolerance test 4 h post retro-orbital bleeding and found that both glucose and water induced IL-6, suggesting that the acute stress of gavaging and bleeding, but not hyperglycemia, was responsible for IL-6 induction (Figures S1F and S1G). We also wanted to exclude the possibility that local damage to the retro-orbital plexus was inducing regional endothelial or immune release of IL-6, and so we sampled the contralateral orbital plexus and did not observe differences between traumatized and untraumatized eyes, suggesting that the contribution of systemic IL-6 was not significantly affected by local damage (Figure S1H).

Figure thumbnail gr2

Figure 2Stress-inducible IL-6 is produced by brown adipocytes

IL-6 is produced by many cell types, including hematopoietic cells, myocytes, endothelial cells, and adipocytes (

). To identify the origin of IL-6, we first performed mixed bone marrow chimera studies by using IL-6-deficient animals and found that stress-induced IL-6 was not produced by radiosensitive cells (Figure 2B). Given the kinetics of plasma IL-6 after acute stress, we reasoned that IL-6 would be transcriptionally regulated. Thus, we screened multiple tissues for Il6 induction using both the bleeding and tube restraint models. We found that Il6 was robustly induced in the brown adipose tissue (BAT) (Figure 2C) and confirmed protein expression by immunohistochemistry (Figure 2D). We did not detect increased muscle Il6, which was consistent with the observation that mice did not significantly increase physical activity after an acute stressor (Figure S2B). To test if BAT was the sole source of stress-induced IL-6, we surgically excised the BAT, which ablated the IL-6 response to bleeding stress (Figure 2E).

Figure thumbnail figs2

Figure S2IL-6 Is Necessary for Promoting Stress-Hyperglycemia, Related to 

Because BAT is a complex collection of cells including radioresistant immune cells (

), we first asked if stress-induced Il6 would be present in the stromal vascular fraction (SVF), which includes all cells except adipocytes. The purity of our SVF isolation was verified by the absence of Ucp1 and beta-3 adrenergic receptor (Adrb3) expression (Figures S1I and S1J). Il6 transcriptional induction was not observed in the SVF fraction from either bled or restrained animals, implying that stress-induced IL-6 was derived from brown adipocytes (Figure 2F). Thus, we generated an animal in which Il6 could be inducibly deleted in brown adipocytes by using Ucp1 promoter-driven Cre under the control of estrogen receptor (Il6f/fΔUCP1) and detected a significant attenuation of IL-6 after acute stress in these animals (Figure 2G). Collectively, our data demonstrate that brown adipocytes are the source of stress-induced IL-6.

 ADRB3 mediates brown-adipocyte-derived IL-6 in response to acute stress independently of thermoregulation

Because BAT is critical for non-shivering thermogenesis in cold and psychological stress (

), we assessed the effect of ambient temperature on stress-induced IL-6. We subjected animals placed in standard cold acclimation (4°C), standard (22°C), and thermoneutral (32°C) conditions to bleeding stress, and did not note any effect on IL-6 induction (Figure S1K). To test whether the key mediator of non-shivering thermogenesis, UCP1, was required for IL-6, we tested the IL-6 response in Ucp1-deficient animals. Consistent with a function independent from thermoregulation, we did not note differences in either endocrine IL-6 levels or BAT transcriptional upregulation of Il6 (Figures 3A and 3B ). We also did not note any temperature differences after bleeding stress in the presence of IL-6Ra-blocking antibody compared with the isotype control (Figure S1L). Transcriptional analyses of BAT after acute stress did not demonstrate induction of Ucp1 or other classic cold-responsive genes (Figure S1M). Interestingly, mRNA transcript for Il5, which was detected as a stress-induced cytokine after bleeding (Figure 1B), was also produced in the BAT. This finding is reminiscent of the reported role of IL-5 in BAT adaptation to prolonged cold exposure (

;

).

Figure thumbnail gr3

Figure 3ADRB3 mediates brown adipocyte-derived IL-6 in response to acute stress

We reasoned that consciousness would be required for IL-6 response to acute stress. Thus, we anesthetized animals with either ketamine/xylazine or isoflurane, after which we subjected them to tube restraint or retro-orbital bleeding and found that anesthesia abrogated stress-induced IL-6 (Figure 3C). Because sympathetic outflow to BAT is well-described in settings of acute exposure to cold (

;

) and psychological stress (

), where projections originate from the rostral medullary raphe region and dorsomedial hypothalamus, we hypothesized that IL-6 was induced via beta-adrenergic signaling. To test if sympathetic neurons were required for stress-induced IL-6, we utilized 6-hydroxydopamine (6-OHDA) at doses that achieve significant BAT sympathectomy without significant effects on the CNS (

). After 6-OHDA treatment, we found that stress-inducible IL-6 was significantly attenuated, confirming that sympathetic outflow was required (Figure 3D). Because all three beta-adrenergic receptors are present in BAT (Figures S1J, S1N, and S1O), we asked which of these played a role in mediating stress-induced IL-6. We thus challenged animals with ADRB agonists and found that the ADRB3 agonist CL316,243, but not the ADRB1/2 agonist isoproterenol, was sufficient to induce IL-6 (Figures 3E and 3F), consistent with previous reports (

;

). Concordantly, pre-treatment with the pharmacologic inhibitor of ADRB3, but not ADRB1/2 (Figures 3G and S1P) or genetic deletion of Adrb3 (Figure 3H), abrogated stress-induced IL-6. These experiments demonstrate that ADRB3 is necessary and sufficient for acute-stress-induced IL-6. Because many cell types express Adrb3, we generated animals in which Adrb3 could be inducibly deleted from brown adipocytes (Adrb3f/fΔUCP1) and verified that tamoxifen induction efficiently deleted Adrb3 (Figure S1Q). As expected, and consistent with Il6f/fΔUCP1 animals (Figure 2G), stress-inducible IL-6 was significantly attenuated in Adrb3f/fΔUCP1 mice (Figure 3I). These data are consistent with a UCP1-independent ADRB3-dependent endocrine function of brown adipocytes and suggest that BAT may function as an endocrine organ sensitive to adrenergic outflow triggered by acute stress.

 IL-6 is necessary for maintaining hyperglycemia after acute stress

Given the large induction of IL-6 by stress alone, we hypothesized that IL-6 was coordinating stress physiology. Classical “fight or flight” physiology includes autonomic outflow and metabolic reprogramming toward catabolic metabolism, which is thought to fuel the increased energy demand anticipated in threatening situations (

). We did not detect significant changes in the quantity of canonical stress hormones (Figures S1C and S1D) or stress-induced heart rate or hypertension (Figure S2A) after acute stress in the absence of IL-6 function, suggesting that autonomic output was not significantly impacted by IL-6. In contrast, using indirect calorimetry, we did detect significant differences in the overall energy expenditure of stressed animals in which IL-6 signaling was antagonized (Figure 4A) despite no significant changes in total activity of animals in either group (Figure S2B). We thus hypothesized that organismal metabolic re-programming was likely a key function of stress-induced IL-6, consistent with the numerous studies that have reported a role for IL-6 in affecting organismal metabolism in various contexts (

;

;

;

;

).

Figure thumbnail gr4

Figure 4IL-6 is necessary for promoting stress-hyperglycemia
We thus examined metabolic changes induced by acute stress at the peak of endocrine IL-6 levels. We found that stress-induced hyperglycemia was durable at 4 h after acute stress in an IL-6Ra-dependent fashion (Figure 4B). A single bolus of stress-dosed IL-6 was also sufficient to recapitulate the effects of acute stress (Figure S2C), indicating that IL-6 was both necessary and sufficient to induce stress-hyperglycemia at this time point. Hyperglycemia is caused by impaired clearance (insulin resistance) and/or excess glucose production from glycogenolysis or gluconeogenesis. To determine which of these processes was causing hyperglycemia, we tested organismal insulin resistance with a glucose tolerance test (GTT) and did not detect significant differences between stressed and unstressed animals (Figure S2D). Likewise, we did not detect differences in GTT in mice challenged with a single bolus of stress-dosed IL-6 (Figure S2E) nor did we detect changes in plasma insulin at peak glycemia after IL-6 challenge (Figure S2F), suggesting the absence of an effect of IL-6 on insulin-dependent glucose uptake. However, when we performed insulin tolerance tests (ITT), we observed that acute stress alleviated insulin-induced hypoglycemia at later time points (Figure S2G), suggesting that stress-induced IL-6 might potentiate endogenous glucose production. Consistent with this idea, a single dose of recombinant IL-6 was also sufficient to recapitulate the effects of acute stress on maintaining higher levels of glucose at late time points during ITT (Figure S2H), and IL-6Ra blockade in stressed animals attenuated the ability of mice to maintain normoglycemia after insulin challenge (Figure S2I). We tested the contribution of glycogenolysis to stress hyperglycemia by examining glycogen content in liver, kidney, and skeletal muscle after stress but did not detect significant differences (Figure S2J). We thus hypothesized that IL-6 was inducing gluconeogenesis during stress.

Gluconeogenesis is typically engaged in hypoglycemic or net negative energy balance states, with the exception of forced intensive exercise, where muscle-derived IL-6 has been shown to induce gluconeogenesis (

;

). To test if gluconeogenesis was impaired in an IL-6-dependent fashion, we measured endogenous glucose production after acute stress and found that it was significantly decreased in the absence of IL-6 signaling (Figure 4C). This finding was supported by pyruvate tolerance tests (PTT) in stressed animals, where pyruvate conversion to glucose was impaired in the absence of IL-6Ra signaling (Figure 4D). Consistent with our previous findings, we found that the effects of IL-6Ra antagonism could be fully recapitulated by using Il6f/fΔUCP1 and Adrb3f/fΔUCP1 animals, which lack stress-inducible IL-6 (Figures 4E and 4F). Gluconeogenic capacity is mediated by key rate-limiting enzymes, many of which have been shown to be sensitive to IL-6 signaling via STAT3 regulatory elements (

). We thus assessed the hepatic transcriptional induction of Pck1G6pc, and other gluconeogenic genes and found that Pck1 and G6pc were significantly increased after acute stress (Figure 4G).

Given the close crosstalk between glucose and lipid metabolism (

), observations of hyperlipidemia in patients receiving anti-IL-6Ra antibodies, as well as the role of free fatty acids on hepatic glucose production (

), we studied lipid metabolism in response to acute stress. The circulating level of free fatty acids and glycerol were not significantly altered in response to retro-orbital bleeding (Figures S3A and S3B). Acute stress decreased circulating triglyceride (TG) levels (Figure S3C), which was likely a result of both enhanced TG clearance (Figure S3D) and suppressed hepatic TG production (Figure S3E). Consistent with clinical observations from patients treated with tocilizumab, anti-IL-6Ra did increase TG in the non-stressed condition (Figure S3F). However, manipulation of IL-6 signaling did not significantly impact triglyceride metabolism in response to acute stress, although stress-induced hypertriglyceridemia did trend lower in IL-6Ra antagonized animals (Figure S3F). We did not detect differences in TG, free fatty acids, glycerol, or β-hydroxybutyrate after intravenous injection of IL-6 (Figures S3H–S3K) or IL-6Ra blockade (Figure S3G), nor did we detect changes in lipolytic capacity in mice with conditional Il6ra deletion in adipose tissue (Figure S3L). Finally, we were unable to detect differences in in vivo fatty acid turnover after anti-IL-6Ra treatment (Figure S3M). Thus, we found that the dominant effect of IL-6 during acute stress is in inducing gluconeogenesis in the absence of a negative energy state to support stress-induced hyperglycemia.

Figure thumbnail figs3

Figure S3Lipid Metabolism in Response to Acute Stress or External IL-6, Related to 

 IL-6Ra in the liver controls stress hyperglycemia through hepatocyte reprogramming

Because the liver and kidney are the major glucose-producing organs (

), we surveyed the transcriptional induction of gluconeogenic genes in both organs and found that they were induced by bleeding stress only in the liver (Figures 5A and S4A). We observed that Il6ra was significantly induced in liver but not in kidney (Figure 5B), suggesting that the liver might be the primary target for IL-6 signaling in response to acute stress. Concordantly, we found that the IL-6/STAT3 target genes, Saa3 and Socs3, were also induced in the liver in response to acute stress (Figures S4B and S4C). To directly assess gluconeogenesis in the liver and kidney, we developed a method to assess the contribution of pyruvate to gluconeogenesis in a tissue-specific manner during stress and found that IL-6Ra antibody suppressed gluconeogenesis from pyruvate in liver but not in kidney (Figures 5C and 5D). We did not detect differences in circulating gluconeogenic amino acids (Figure S4D). Finally, to directly assess the role of hepatocyte IL-6Ra, we generated mice with hepatocyte-specific deletion of Il6ra (Figure S4E) and performed PTT after acute stress. We found that hepatocyte-specific deletion was sufficient to recapitulate the inhibitory effects of systemic IL-6Ra blockade on gluconeogenesis after bleeding (Figure 5E) and restraint stress (Figure 5F). These data indicate that stress-inducible IL-6 acts on the liver to induce hepatic gluconeogenesis.

Figure thumbnail gr5

Figure 5IL-6 mediates stress hyperglycemia through hepatocyte reprogramming
Figure thumbnail figs4

Figure S4IL-6 Mediates Stress Hyperglycemia through Hepatocyte Reprogramming, Related to 

We reasoned that the purpose of activating gluconeogenesis during acute stress, when animals are neither hypoglycemic nor in net-negative energy balance states, is anticipatory of impending increased demand (“fight or flight” response). Consequently, impairment of hepatic gluconeogenesis should be sufficient to affect adaptive behavioral responses to acute stress. To test this, we utilized the light-dark box paradigm. The light-dark box paradigm is a common tool for studying stress response behaviors where animals are placed into a novel environment in which part of the apparatus is exposed under bright light and connected to another enclosed and opaque space by a small opening (

). In this paradigm, animals must balance the need to explore the novel space with the fear of avoiding possible predation in the exposed area. A normal adaptive response is to spend more time in the dark enclosure. We thus established baseline responses of animals with conditional hepatic deletion of Il6ra and then compared the responses at the peak of endocrine IL-6 after a single, conscious, retro-orbital bleed. We found that hepatic IL-6Ra was required for the normal behavioral response (Figures 5G and S4F). Taken in aggregate, we demonstrate that stress-induced IL-6 mediates stress-hyperglycemia through hepatic IL-6Ra signaling in positive energy balance states, and hepatic IL-6Ra is necessary for a normal behavioral response to acute stress.

 ADRB3-dependent IL-6 from BAT potentiates lethal endotoxemia secondary to acute stress

Given the many reported roles of IL-6 in affecting inflammatory responses, we reasoned that stress-induced IL-6 might change the outcome of inflammation. We decided to use the lipopolysaccharide (LPS) model of inflammation, because in this model, mortality is due solely to the inflammatory response without any confounding contribution by pathogens. Animals were subjected to various stress models that induce IL-6 followed by a subsequent LPS challenge. We found that priming animals with stress robustly enhanced mortality to LPS (Figure 6A). For the LPS studies, we opted to use the tube-restraint model to avoid confounders associated with the hemodynamic consequences of bleeding. Because we found that ADRB3 activation was sufficient and required for stress-induced IL-6, we pre-treated animals with ADRB agonists and found that pre-treatment with ADRB3 agonist alone was sufficient to enhance LPS mortality (Figure 6B). Concordantly, a single injection of stress-dosed IL-6 was sufficient to potentiate LPS-induced mortality (Figure 6C). Because stress-induced IL-6 required consciousness, we tested whether or not animals anesthetized prior to tube restraint were still more susceptible to LPS-induced mortality and found that consciousness was required for the stress-priming effect, an effect that could be bypassed with endogenous administration of IL-6 (Figure 6D). To test if ADRB3-dependent IL-6 was necessary, ADRB3 antagonist was applied alongside the restraint challenge, which negated the effects of stress-priming (Figure 6E). Finally, we asked if Il6f/fΔUCP1 animals, which lack stress-inducible IL-6, would be resistant to stress-priming (Figure 6F). Consistent with our hypotheses, Il6f/fΔUCP1, which did not display altered susceptibility to LPS in the absence of stress-priming (Figure S5A), was resistant to the potentiating effects of tube-restraint on LPS mortality. We also tested the effects of stress-priming by using our Il6raf/fΔAlb model. Here, regardless of stress-priming, animals lacking hepatic IL-6 signaling were significantly more sensitive to endotoxemia, suggesting that the hepatic acute phase response was a required adaptation to endotoxemia (Figure S5B), consistent with previous reports (

;

). We also tested if hyperglycemia induced by IL-6 during stress was itself sufficient to prime LPS responses, and thus challenged animals to exogenous glucose to achieve stress hyperglycemia or an isocaloric isovolumetric dose of lipid, and found that glucose, but not lipid, was sufficient to prime the LPS response (Figure S5C).

Figure thumbnail gr6

Figure 6ADRB3-dependent IL-6 from BAT potentiates lethal endotoxemia secondary to acute stress
Figure thumbnail figs5

Figure S5Inflammatory Responses to a Lethal Endotoxemia Are Not Affected by the Pre-exposure of Acute Stress, Related to 

To determine how stress-priming enhanced inflammation-mediated mortality, we first measured cytokine levels and tissue inflammatory gene induction. We did not detect significant changes in circulating or tissue inflammatory cytokines post-LPS in a variety of experimental settings, nor did we detect any changes in tissue inflammatory transcripts or body temperature (Figures S5D–S5R and S6D). Thus, we hypothesized that stress-induced IL-6 might be affecting host tolerance (

;

;

). Because our previous work isolated key brainstem functions (like maintaining heart and respiratory rate) as a target of host tolerance, we also assessed these parameters using our stress paradigm, but did not find significant differences (Figures S6A–S6F). We also did not find large differences in maintaining glycemia, fatty acid, or ketone body levels (Figures S6I–S6K), which we had previously shown to be important in host tolerance to LPS (

). Because end-organ dysfunction is a hallmark of inflammatory damage, we assessed biomarkers of vital organ function in stress-primed versus control animals and found that stress-primed animals displayed significantly more renal and a trend toward more cardiac damage, whereas hepatic damage appeared to be equivalent across conditions (Figures 6G, S6G, and S6H). These markers of end-organ damage were absent in stress-primed Il6f/fΔUCP1 animals (Figure 6H), demonstrating that BAT-derived IL-6 from stress was required for decreasing tolerance to inflammatory damage. Together, these findings suggest that stress decreaseshost tolerance to inflammation in a BAT-derived IL-6-dependent fashion. The precise mechanism by which stress decreases host fitness to inflammation remains to be understood. Altogether, our studies suggest that stress-induced IL-6, although adaptive for supporting fight-or-flight physiology, comes at the cost of decreasing host fitness to endotoxemia-induced inflammation.

Figure thumbnail figs6

Figure S6BAT-Derived IL-6 from Acute Stress Decreases Host Tolerance to Inflammatory Damage, Related to 

Discussion

Psychological stress has been known to induce endocrine IL-6 for nearly 30 years and has been shown in multiple species, including rats, mice, and humans (

;

;

). However, mechanistic understanding for this phenomenon has not been addressed. The evolutionary basis for IL-6 induction during acute stress was unknown, and how this might connect to the long-observed connection between stress, metabolism, and inflammation was also unclear. Our study demonstrates that stress-induced IL-6 is produced from brown adipocytes in an ADRB3-dependent fashion in mice. Thermogenic programs were not engaged in this context, and this response was independent of ambient temperature. One key role of stress-induced endocrine IL-6 is in reprogramming organismal metabolism by instructing hepatic gluconeogenesis in the absence of a net negative energy balance or hypoglycemic state, likely in anticipation of increased glucose demand. Hepatic IL-6 signaling was also necessary for mediating normal behavioral responses in the light-dark box paradigm suggesting that hepatic organismal reprogramming is required for an adaptive “fight or flight” response. Finally, we found that stress-induced BAT-derived endocrine IL-6 was necessary and sufficient for decreasing host tolerance to a subsequent inflammatory response by using the endotoxemia model.

Gluconeogenesis is normally not engaged in positive energy balance states, with the exception of forced exercise (

). In this setting, IL-6 is derived from myocytes and induces hepatic gluconeogenesis. In our study, we did not observe any IL-6 induction in muscle, nor did we observe increased activity after stress, and instead found that brown adipocytes were indispensable in the setting of acute stress. It is interesting to speculate why IL-6, which can be derived from many different cell types, is produced by brown adipocytes in this context. The BAT has a number of features that make it an ideal endocrine organ responsive to acute psychologic stress. It is highly innervated, and thus capable of immediate responsiveness after detection of stress, a feature that has been clearly demonstrated in acute cold exposure for the purpose of defending body temperature. In addition, blood flow through BAT can be quickly increased (hyperemia) (

) and, in the setting of acute cold exposure, is optimal for quickly circulating warmed blood, or, in this case, a stress hormone. Interestingly, BAT hyperemia and thermogenesis can be decoupled, suggesting that there could be scenarios where uncoupled respiration is not necessary for hyperemia (

). In our study, we did not find that ambient temperature played a role in stress-inducible IL-6, observe transcriptional induction of the thermogenic program, find differences in body temperature as a function of IL-6 signaling, or demonstrate a requirement for UCP1. We speculate that perhaps through other contextual inputs, such as the cold-sensor TRPM8 (

;

), might be required to activate the full thermogenic program. From this perspective, BAT can thus be considered a stress-responsive endocrine organ that might have several responses depending on other contextual inputs. Finally, BAT is highly enriched in ADRB3. Unlike ADRB1 or ADRB2, ADRB3 has been shown to be less easily desensitized (

), thus providing more durable responsiveness to adrenergic outflow. Consistent with this idea, we found that repeated stress-exposure over the course of 24 h maintained elevated plasma IL-6 levels. The role of BAT in adult humans is controversial because its detection is dependent upon the approach employed (

;

;

). It is principally confined to clavicular and para-aortic areas, which might be why less stress-associated IL-6 is recovered in humans than in mice if it is even made in human BAT at all (

). On the other hand, recent work suggests that BAT of “humanized” mice is notably similar to human BAT (

). It remains unclear how the mechanistic insights from our studies in rodents will translate to humans.

Our work further highlights the complexity of adrenergic signaling in physiology. Although signaling on ADRB2 in immune cells has largely been shown to be anti-inflammatory (

;

), our study suggests that ADRB3 activation after acute stress exposure might be detrimental for adaptation to a subsequent inflammatory challenge. The clinical observation that sympathetic mimetics enhance survival in septic shock might be resultant from the effects of supraphysiological dosing on supporting blood pressure that might be the dominant mechanism of protection regardless of its other effects.

Like adrenergic biology, the role of IL-6 in inflammation and metabolism is similarly complex. IL-6 is generally considered a pro-inflammatory cytokine, which is supported by the efficacy of IL-6 blockade in inflammatory diseases (

). On the other hand, several studies demonstrate an anti-inflammatory role for IL-6 (

;

). In our study, we demonstrate that BAT-derived IL-6 is required for stress to enhance end-organ damage and mortality caused by the LPS model. Likewise, we found that pre-exposure to peak plasma levels of stress-induced IL-6 was sufficient to increase end-organ damage and potentiate mortality. In the LPS model, which might not be generalizable to other models of inflammation, we found that although stress did not meaningfully increase inflammatory magnitude, hemodynamic or cardiopulmonary parameters, or gross metabolic parameters, it nonetheless led to measurable worsening of end-organ function and death. The mechanism underlying this phenomenon is unclear, but likely is a result of stress-induced IL-6-dependent metabolic re-programming similar to that which has been previously published by our group and others (

;

;

;

;

). Whether other types of inflammatory challenges would also be affected by the models of acute stress used here, and, more generally, how different types, degrees, and durations of stress affect tissue tolerance in different inflammatory settings is an open question, as is the precise mechanism for how IL-6 primes LPS-mediated mortality. Moreover, it remains unclear if the elevated levels of circulating IL-6 seen in aging and obesity or after exercise would also drive differences in host tolerance to inflammation. Similarly, from a metabolic perspective, IL-6 has been shown to be both insulin sensitizing and insulin desensitizing depending on the context. In contexts of chronically increased IL-6 such as obesity or rheumatoid arthritis, IL-6 has been shown to induce insulin resistance (

;

;

). On the other hand, in these same contexts, others have shown that IL-6 induces insulin sensitivity (

;

;

;

;

;

), whereas IL-6 has been shown to be insulin sensitizing in exercise (

). Our study did not find that IL-6 was playing a role in insulin sensitivity after stress. Our animals were all lean, chow-fed animals, and thus in a net energy positive state. One main finding of our study is that IL-6 is a distinct inductive signal to instruct hepatic gluconeogenesis during net energy positive states. Unlike during fasting, ketogenic diets, or other hypoglycemic states where gluconeogenesis programs are mediated primarily by CREB/FoxO1 programs (

), which are responsive to low energy states, stress induces gluconeogenesis even in net positive energy balance states. Our data suggest that IL-6 signaling in hepatocytes is required for gluconeogenesis in non-net negative energy balance states. Although IL-6 does not appear to increase gluconeogenesis at rest (

), our studies resonate well with other studies demonstrating STAT3 regulation of the same gluconeogenic genes such as Pck1 and G6pc and with studies demonstrating a role for IL-6 in exercise-mediated hepatic gluconeogenesis (

). Here, it is interesting to consider the similarities between psychological stress and forced exercise. Thus, we propose a model wherein IL-6 is a necessary signal that instructs gluconeogenesis in net energy positive states as an anticipatory, (impending increase in glucose demand), as opposed to responsive adaptation (Figure 7).

We found that hepatic IL-6 signaling was required for a normal behavioral adaptation to stress. Numerous studies have reported that intracranial IL-6 and IL-6 signaling by using non-canonical trans-signaling modalities impact behavior (

). Our findings that hepatocyte expression of Il6ra is required for normal behavioral response to acute stress are in line with recent studies using chronic models of stress (

;

;

), where the use of blocking antibodies to IL-6Ra, which do not cross the blood brain barrier (

), promoted resilience to social stress. These studies suggest a necessary peripheral role for IL-6 in mediating behavioral changes, consistent with our findings. It is possible that hepatocyte IL-6Ra would be required in these models of chronic stress as well. Indeed, the light-dark box paradigm we utilized in this study is commonly used in depression and anxiety studies, and IL-6 has been implicated in depression for many years (

). On the other hand, aerobic exercise, which also induces IL-6 (

;

;

), is highly associated with improved outcomes in depression and anxiety. Thus, it remains to be seen in on-going clinical trials (i.e., NCT02660528) if elevated IL-6 observed in depressed patients is pathogenic.

Our studies suggest that the degree of stress experienced by an animal at the time of inflammatory challenge might be one important factor for determining its disease trajectory. Understanding which environmental factors—such as timing to the last meal bolus or other determinants that are proxies for the “stressfulness” of the environment—might contribute to the stochasticity observed in genetically identical organisms subjected to identical challenges, which is an area of active study that might shed insight into mechanistic determinants of disease trajectories.

In summary, this study identifies a brain-BAT-liver axis in mice whereby IL-6 modulates glucose metabolism under conditions of acute stress and suggests that there is an adaptive purpose for inducing IL-6 in acute stress. We speculate that maladaptive states might arise in chronic stress where IL-6 becomes persistently elevated. Whether or not ADRB3 or IL-6Ra receptor biology changes as a function of chronic IL-6 states, as has been shown for the glucocorticoid and insulin receptors (

;

), remains to be seen. Should this brain-BAT-liver axis also be relevant in humans, our findings have implications for the pathogenesis of psychiatric diseases such as seasonal affective disorder, where depression occurs primarily as a function of cold and dark seasons, and also implicate ADRB3 and IL-6 as potential therapeutic targets for preventing disease flares in conditions of pathologic inflammation.

 Limitations of study

These experiments were performed on mice in a single facility and largely on the C57BL/6J genetic background. The impact of the microbiota, genetic background, and facility-specific factors are unknown, and the unnatural settings in animal facilities likely affect the results and interpretation of physiology studies, including this one. It is likely that stress-induced IL-6 plays additional roles besides those described in our studies. There are a number of open questions raised by our study. Does psychological stress affect all types of inflammation the same? How do different stressors and degrees of stress affect inflammation? Are our observations informative for placebo and nocebo biology? Finally, the translatability of this study to humans is to be determined.

STAR★Methods

 Key Resources Table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-mouse IL6 eBioscience Cat#14-7061-85; RRID: AB_468422
Biotin-conjugated anti-IL6 BD PharMingen Cat#554402; RRID: AB_395368
HRP-conjugated streptavidin BD Bioseiences Cat#554066
Anti-mouse TNFa eBioscience Cat#14-7423-85; RRID: AB_468492
Anti-mouse IL-1β Invitrogen Cat#14-7012-81; RRID: AB_468396
Biotin-conjugated anti-TNFa Invitrogen Cat#13-7349-81; RRID: AB_466952
Biotin-conjugated anti-IL-1β eBioscience Cat#13-7112-85; RRID: AB_466925
InVivoMAb anti-mouse IL-6R Bio X Cell Cat#BE0047; RRID: AB_1107588
InVivoMAb rat IgG2b isotype control, anti-keyhole limpet hemocyanin Bio X Cell Cat#BE0090; RRID: AB_1107780
Biological Samples
Human plasma Yale Stress Center N/A
Chemicals, Peptides, and Recombinant Proteins
Recombinant mouse IL6 R & D Cat#406-ML
Recombinant mouse TNFa R & D Cat#410-MY
Recombinant mouse IL-1β R & D Cat#401-ML-010
NEFA standard solution Wako Diagnostics Cat#276-76491
HR series NEFA-HR(2) color reagent A Wako Diagnostics Cat#999-34691
HR series NEFA-HR(2) solvent A Wako Diagnostics Cat#995-34791
HR series NEFA-HR(2) color reagent B Wako Diagnostics Cat#991-34891
HR series NEFA-HR(2) solvent B Wako Diagnostics Cat#993-35191
Multi-calibrator lipid Wako Diagnostics Cat#464-01601
L-type triglyceride M enzyme color A Wako Diagnostics Cat#994-02891
L-type triglyceride M enzyme color B Wako Diagnostics Cat#990-02991
Intralipid 20% Sigma-Aldrich Cat#1141
Poloxamer 407 Sigma-Aldrich Cat#16758
Glucose, D-[3-3H] PerkinElmer Cat#NET331C250UC
Potassium palmitate (U-13C16) Cambridge Isotope Laboratories Cat#CLM-3943-PK
Sodium L-lactate-3-13C solution Sigma-Aldrich Cat#490040
6-hydroxydopamine Sigma-Aldrich Cat#H4381
Lipopolysaccharides from Escherichia coli O55:B5 Sigma-Aldrich Cat#L2880

Lot#039M4004V

Isoproterenol Sigma-Aldrich Cat#1351005
CL316243 Sigma-Aldrich Cat#C5976
Propranolol Sigma-Aldrich Cat#P0884
SR59203A Cayman Chemical Cat#21407
Critical Commercial Assays
Mouse cytokine array/chemokine array 44-plex (MD44) Eve Technologies N/A
Human cytokine array/chemokine array 42-plex with IL-18(HD42) Eve Technologies N/A
Glycerol assay kit Sigma-Aldrich Cat#MAK117-1KT
β-hydroxybutyrate colorimetric assay kit Cayman Chemical Cat#700190
Corticosterone ELISA kit Enzo Life Sciences Cat#ADI-900-097
Mouse insulin ELISA kit Crystal Chem Cat#90080
Noradrenaline ELISA kit Eagle Biosciences Cat#NOR31-K01
Mouse CTnI Life Diagnostics Cat#CTNI-1-US
Alanine transaminase colorimetric activity assay kit Cayman Chemical Cat#700260
Experimental Models: Organisms/Strains
Mouse: C57BL/6J The Jackson Laboratory 00064
Mouse: Adrb1 tm1Bkk Adrb2 tm1Bkk The Jackson Laboratory 003810
Mouse: B6.129-Ucp1 tm1Kz The Jackson Laboratory 003124
Mouse: B6;SJL-Il6ra tm1.1Drew / J The Jackson Laboratory 12944
Mouse: B6. FVB(129)-Tg(Alb-cre)1Dlr / J The Jackson Laboratory 016832
Mouse: B6. 129-Tg(Adipo q-cre/Esr1)1Evdr / J The Jackson Laboratory 024671
Mouse: Adrenalectomy and sham surgery The Jackson Laboratory https://www.jax.org/jax-mice-and-services/find-and-order-jax-mice/surgical-and-preconditioning-services/surgical-service-for-jax-mice
Oligonucleotides
Primers for mouse Il6 Forward This paper TGAACAACGATGATGCACTTG
Primers for mouse Il6 Reverse This paper CTGAAGGACTCTGGCTTTGTC
Primers for mouse Il6ra Forward This paper AGACCTGGGACCCGAGTTAC
Primers for mouse Il6ra Reverse This paper AAGGTCAAGCTCCTCCTTCC
Primers for mouse Fbp1 Forward This paper TGGTTCCGATGGACACAAGG
Primers for mouse Fbp1 Reverse This paper CCAATGTGACTGGGGATCAAG
Primers for mouse Gck Forward This paper TTACACTGGCCTCCTGATGG
Primers for mouse Gck Reverse This paper TTTGCAACACTCAGCCAGAC
Primers for mouse Ucp1 Forward This paper GTGAACCCGACAACTTCCGAA
Primers for mouse Ucp1 Reverse This paper TGCCAGGCAAGCTGAAACTC
Primers for Pck1, G6p, Pcx, Adrb3, Adrb1, Adrb2, Rpl13a, Ikkb, Tnfa, Cxcl1, Mx1, Il12b, Saa3, Prdm16, Il5, Ssa3, Socs3, See Table S1 This paper N/A
Software and Algorithms
Prism 8.0 GraphPad Software, Inc. N/A

 Resource Availability

 Lead Contact

Further information and requests for reagents may be directed to, and will be fulfilled by, the lead contact Andrew Wang (andrew.wang@yale.edu).

 Materials Availability

This study did not generate new reagents. Mouse lines for this study are available from the Lead Contact with a completed Materials Transfer Agreement.

 Data and Code Availability

This study did not generate any datasets/code amenable for depositing into public repositories.

 Experimental Model and Subject Details

 Mice

Male mice with 6-8 weeks of age were used. C57BL/6J, Adrb1/b2 KO, Ucp1 KO, Il6ra f/f, AlbCre, AdipoCre mice were purchased from Jackson Laboratories and bred at Yale University. Adrb3 KO mice were a kind gift from Dr. Natasa Petrovic (Stockholm University), Adrb3 f/f mice were a kind gift from Dr. Jean-Luc Balligand (UC Louvain), the Ucp1CreER animal was a kind gift from Dr. Wolfrum Chrsitian (ETH Zurich), the Il6 f/f was a kind gift from Dr. Juan Pareja (Universitat Autonoma Barecelona) and the Tlr2/4 KO, and Myd88/Trif KO animals were kindly provided by Dr. Ruslan Medzhitov. Adrenalectomy and sham surgery mice were purchased from Jackson Laboratories. All animal experiments were performed according to institutional regulations upon review and approval of Yale University’s Institutional Animal Care and Use Committee.
For stress models, all experiments were done during the light period. Acute restraint stress was initiated by retaining a mouse in a ventilated 50ml Falcon tube for four hours. Social isolation was induced by individually housing mouse for three days. Retro-orbital bleeding (50 μL of blood drawn via a glass cuvette VWR #53432-921) was performed four hours before experiments, then blood was collected from the other eye for analysis. In the cage switch model, mice were removed from their home cage and placed in new cage of the same size with dirty bedding of other non-littermate males. Non-disturbed socially-housed littermates were applied as the controls. For anesthesia studies, ketamine/xylazine was injected intraperitoneally or animals were placed in isoflurane chambers. Verification of anesthesia was confirmed by lack of activity after toe pinching. Chemically sympathectomized with 6-hydroxydopamine (6-OHDA, sigma) was applied through intraperitoneal injection 24 hours before acute stress at a dosage of 10 mg/kg. For manipulation of ambient temperature, mice were either housed at thermoneutral (32°C) cabinets for two weeks, or placed in the cold (4°C) for three hours, or housed at standard housing (22°C).
For flux and metabolite measurements, mice underwent surgery under isoflurane anesthesia to place a catheter in the left jugular vein. Animals were individually housed with unrestricted access to food and water and were treated again with IL-6Ra antibody or isotype control the night before a 120 min tracer infusion, performed after two hours of acclimation to a 1.25 inch diameter plastic restrainer (IBI Scientific) in which the mouse’s tail was drawn through the restraint and tethered with tape, while an adjustable nose cone permitted the mouse several centimeters of forward movement. At the conclusion of the tracer infusion, mice were euthanized via IV pentobarbital and liver and kidney were obtained and freeze-clamped in liquid N2 within 30 s of euthanasia.
For LPS endotoxemia, mice were injected intraperitoneally with LPS derived from Escherichia coli 055:B5 (Sigma-Aldrich) diluted in PBS. Dosing varies dramatically from lot to lot. New lots are tested for LD50. In these studies, lethal doses are between 15 and 20 mg/kg. For experiments with antibody blockade, anti-IL-6Ra or the isotype antibody (BE0047 and BE0090 respectively, Bio X Cell, 8 mg/kg) diluted in PBS was injected intravenously one night before experiment through retro-orbital injection. For experiments utilizing recombinant IL-6, recombinant mouse IL-6 (406-ML-025/CF, R&D) or PBS control was intravenously injected one hour before experiment at a dose of 5ng/100 μl/mouse through the retro-orbital plexus. For experiments utilizing adrenergic agonists, ADRB1/2 agonist (Isoproterenol, 1351005, Sigma-Aldrich, 1mg/kg), ADRB3 agonist (CL316243, Sigma-Aldrich, 1mg/kg) were injected intraperitoneally two hours prior to blood and tissue harvesting. For adrenergic antagonists, propranolol (5 mg/kg, P0884, Sigma-Aldrich) and ADRB3 antagonist (SR59203A, 21407, Cayman Chemical, 5mg/kg) were applied once every two hours during four-hour-exposure of acute stresses, blood were collected at indicated time point, and lethal dose of LPS was administered two hours after last injection of ADRB3 antagonist.
Vital signs, including blood oxygen saturation, breath rate, and heart rate post LPS injection were monitored via pulse oximetry using the MouseOx Plus (Starr Life Sciences Corp.). Core body temperature was measured by rectal probe thermometry (Physitemp TH-5 Thermalert).

 Human Subjects

A community sample of individuals signed written informed consent for research approved by the Yale Institutional Review Board and was carefully assessed for high and low stress using a structured cumulative stress and adversity interview that assessed recent and past life events (Cumulative Adversity Interview (CAI)) (

;

;

). The high and low groups were group matched on age, gender, education and body mass index (BMI). All subjects participated in two standardized experiment sessions on consecutive days conducted between 2:00 and 4:00 pm in the afternoon. Baseline blood draws were drawn at 2 pm after a one-hour habituation period and two additional draws were conducted within 15 minutes. Change from baseline values were computed to assess baseline adjusted values and reduce variability across subjects.

 Method Details

 Quantification of Plasma Cytokines

Undiluted plasma from stressed mice were screened by Eve Technologies using mouse cytokine arrays, the raw data including standard results were presented in Figure S7A. Except for the results in Figures 1B and S1E from samples analyzed by Eve Technologies, other analyses were conducted in our laboratory. Plasma concentrations of IL-6 were assayed by sandwich ELISA (

;

). Anti-mouse IL-6 capture antibody (14-7061-85, eBioscience) was diluted (1:1000) in coating buffer (NaHPO4 PH 9) then incubated in enhanced protein-binding ELISA-grade plate (490012-252, VWR) overnight at 4°C. On the next day plates were blocked using PBS buffer with 10% FBS for one hour at room temperature. Afterward, the standards and plasma from stressed mice were incubated in the plate overnight at 4°C. The highest concentration of recombinant IL-6 standard (406-ML, R&D) was 10ng/ml followed by serial two-fold dilutions to create a standard curve, and plasma were diluted 1:5 (20ul plasma in 80ul blocking buffer per well). On the third day, biotin-conjugated anti-IL-6 detection antibodies (554402, BD PharMingen) was diluted (1:500) and incubated in the plate for one hour at room temperature, followed with another incubation of diluted (1:1000) HRP-conjugated streptavidin (554066, BD Biosciences) for half an hour at room temperature. Then plates were incubated in the dark at room temperature with TMB substrate reagent (555214, BD Biosciences) and the color was checked every five minutes. Then plates were read at 450nm instantly after stop solution (3M H2SO4) was added. Between each step, five to seven times of washing were normally applied. The raw data, results of standard curve and representative plate with color developed with TMB were displayed in Figures S7B–S7E. Plasma concentrations of TNFα and IL-1β were assayed by the same sandwich ELISA method. Recombinant TNFα (410-MY, R&D) and IL-1β (401-ML-010, R&D) were utilized as standards with the highest concentration at 10ng/ml and 1ng/ml respectively. Capture antibodies were anti-TNFα (14-7423-85, eBioscience) and anti-IL-1β (14-7012-81, Invitrogen). Detection antibodies conjugated with biotin were anti-mouse TNFα (13-7349-81, Invitrogen) and anti-mouse IL-1β (13-7112-85, eBioscience). HRP-conjugated streptavidin, TMB substrate reagent, and stop solution were the same with those in ELISA assay for IL-6 measurement.

Figure thumbnail figs7

Figure S7Raw Data from ELISA Analysis of IL-6, Related to B, D, and G

 Quantification of Plasma Metabolites, Hormones, and Organ Injury Markers

Glycemia was measured by whole blood collection via the retro-orbital plexus and assessed using a glucometer (OneTouch), or, during the flux studies in IL-6Ra treated mice, in blood collected from the tail vein using the YSI Glucose Analyzer. Plasma was separated using lithium heparin-coated microcentrifuge tubes (BD Diagnostics). Plasma L-type triglycerides (TG) and nonesterified fatty acids were measured using the kits according to manufacturer’s instructions (Wako Diagnostics). Plasma Glycerol and β-hydroxybutyrate were measured using the kits per manufacturer’s instructions (Sigma Aldrich and Cayman Chemical, respectively). Plasma amino acid concentrations were measured by gas chromatography-mass spectrometry (GC-MS) as described previously (

). Plasma levels of corticosterone (Enzo Life Sciences), insulin (Crystal Chem), and noradrenaline (Eagle Biosciences) were measured using kits according to the manufacturer’s protocols. Cardiac Troponin-I (CTNI) concentration and Alanine Aminotransferase (ALT) activity in the blood were measured by kits per manufacturers’ instructions (Life Diagnostics and Cayman Chemical, respectively). Plasma creatinine were assayed using HPLC by the George M. O’Brien Kidney Center at Yale.

 Surgical Removal of Brown Adipose Tissue

Surgical removal of brown adipose tissue (BAT) was applied to seven weeks old male mice. A 1.5 cm incision was made to expose the intrascapular fat pads following intraperitoneal injection of ketamine/xylazine. Two lobes of darkly colored BAT were completely removed with little bleeding. Sham-operated mice were anesthetized and incisions were made into the muscles without tissue excision. Heat mats were applied to keep all animals warm during and after surgery until consciousness was fully recovered. Then mice were kept in room temperature, and IL-6 secretion post retro-orbital bleeding was analyzed in these mice two days after surgery.

 Metabolic Tolerance Tests

For oral GTT, D-Glucose (G8270, Sigma-Aldrich) or water gavage was performed; blood was collected afterward through retro-orbital plexus at indicated time point for glucose and IL-6 analysis. For intraperitoneal GTT, D-glucose was given through intraperitoneal injection at the dose of 2g/kg. CBG was analyzed using a glucometer (OneTouch) at indicated time points. For insulin tolerance tests, insulin (Novolin R) was administrated at 2 IU/kg through intraperitoneal injection. For pyruvate tolerance tests, pyruvate (Sigma-Aldrich) was applied at 2g/kg by intraperitoneal injection. CBG was analyzed at indicated time points. For lipid tolerance tests, intralipid 20% (1141, Sigma-Aldrich) was intraperitoneally injected at a volume of 200 μL per mouse. Plasma level of TG was analyzed at 0, 1, 2, 3, and 4 hours after intralipid administration. For hepatic triglyceride production, poloxamer 407 (16758, Sigma-Aldrich) was dissolved in PBS and then intraperitoneally injected at 1g/kg. Plasma level of TG was analyzed at 0, 1, 2, 3, and 4 hours after poloxamer injection. Mice were fasted overnight before the hepatic TG production assay and assessment of glucose and palmitate turnover; for all other tolerance tests, stressed or unstressed mice were fasted for four hours before testing. Capillary blood glucose (CBG) was analyzed using a glucometer (OneTouch) at indicated time points.

 Endogenous Glucose Production and Palmitate Turnover

After anti-IL-6Ra treatment, endogenous glucose production and palmitate turnover from C57BL/6J mice were measured as precious described (

,

). In brief, IL-6Ra inhibitor or vehicle control was injected through orbital venous plexus respectively before catheter placement and tracer infusions. Mice were infused with [3-3H] glucose (10 μCi/min, PerkinElmer), [U-13C16] potassium palmitate (2.5 μmol/kg/min, Cambridge Isotopes), and [3-13C] sodium lactate (40 μmol/kg/min, Sigma) continuously for a total of two hours following a 5 min 3X prime. Palmitate turnover was determined by gas chromatography-mass spectrometry (GC-MS) (

). Plasma specific activity was measured using a scintillation counter and compared to tracer specific activity to measure whole-body endogenous glucose production, which can be attributed entirely to gluconeogenesis in a 16 hr fasted, glycogen-depleted mouse. Based on equations previously described (

), and after verifying minimal (atom percent enrichment < 1%, as compared to glucose 15%–20%) renal and hepatic bicarbonate enrichment, we measured the whole-body ratio of pyruvate carboxylase flux (i.e., gluconeogenesis from pyruvate) to total gluconeogenesis by mass isotopomer distribution analysis (MIDA):

GNGfrompyruvate=[C213]glucoseXFE2GNGfrompyruvate=[C213]glucoseXFE2
(1)

where XFE represents the fractional triose enrichment and is calculated as

XFE=11+[C113]glucose2[C213]glucose.XFE=11+[C113]glucose2∗[C213]glucose.
(2)

In these calculations, we corrected for any [13C2] glucose synthesized from [13C2] trioses – as opposed to the condensation of two [13C1] trioses – by GC-MS measurement of the enrichment in the glucose C4C5C6 fragment, according to the equation

Corrected[C213]glucose=Measured[C213]glucose2[C4C5C6C213]glucoseCorrected[C213]glucose=Measured[C213]glucose−2∗[C4C5C6−C213]glucose
(3)

This ratio was measured in plasma (representing whole-body gluconeogenesis from pyruvate), liver, and renal cortex. By comparing the whole-body gluconeogenesis from pyruvate (GNG from pyruvateT) to that measured in liver (GNG from pyruvateL) and kidney (GNG from pyruvateK), we were able to measure the fractional contribution of the kidney to whole-body gluconeogenesis (GNGK/GNG)(GNGK/GNG):

(GNGKGNG)=1GNGfrompyruvateTGNGfrompyruvateKGNGfrompyruvateLGNGfrompyruvateK(GNGKGNG)=1−GNGfrompyruvateT−GNGfrompyruvateKGNGfrompyruvateL−GNGfrompyruvateK
(4)

Absolute rates of gluconeogenesis from kidney could then be calculated by multiplying the measured endogenous glucose production by (GNGK/GNG)(GNGK/GNG) (Equation 4), and gluconeogenesis from liver was calculated as the difference between total endogenous glucose production and gluconeogenesis from kidney. The rate of gluconeogenesis from liver and kidney was then multiplied by the fractional contribution of pyruvate to gluconeogenesis in those tissues to calculate the contribution of pyruvate to gluconeogenesis in each tissue.

 qRT-PCR

Tissues were homogenized in 1ml RNA-Bee (Tel-Test, Inc) using a FastPrep-24 5G homogenizer (MP Biomedicals). RNA was purified using QIAGEN RNeasy columns according to the manufacturer’s instructions. cDNA was generated with reverse transcriptase (Clontech) using oligo-dT6 primers (Sigma-Aldrich). qRT-PCR was performed on a CFX96 Real-Time System (Bio-Rad) using PerfeCTa SYBR Green SuperMix (Quanta Biosciences). Relative expression units were calculated as transcript levels of target genes relative to Rpl13a. Primers used for qRT-PCR are listed in Table S1.

 Stromal Vascular Fraction Isolation

Stromal vascular fraction (SVF) were isolated by density separation as previously reported (

). Briefly, interscapular BAT depots were minced and digested in collagenase at 37°C for 1 hour with constant agitation. Then after filtering through 70 μM cell strainer, the cell suspensions were centrifuged at 500 g for 5 min. The pellet was the SVF fraction.

 Metabolic Cage

Energy expenditure after acute stress was measured by indirect calorimetry using metabolic cages (Promethion, Sable Systems International). A 2-day period of acclimation was followed by 2 days of steady-state recording prior to experimentation. Afterward, C57BL/6J mice were given IL-6Ra antibody or isotype control through intravenous injection; the next morning, both groups were subjected to retro-orbital bleeding stress.

 Ambulatory Blood Pressure Measurements

A blood pressure transducer (TA11-PA-C10, commercially available through Data Sciences International) was surgically implanted under isoflurane anesthesia (1%–3% in oxygen) into the carotid artery of mice using sterile surgical technique. Meloxicam was provided for 48 hours for post-operative analgesia and the skin was closed with surgical staples. Mice were allowed to recover for 7 days. Afterward, surgical staples were removed, and the mice were transferred to a fresh cage and singly housed for data collection. There they were allowed to acclimate for several days prior to initiation of study. A 10 s segment was collected every minute for the duration of the experiment. Every dot in the figure reflects the averaged value over one hour reading period.

 Behavioral Tests

The spontaneous exploratory behavior of mice following acute stress was analyzed three hours post retro-orbital bleeding using the light-dark paradigm. All experiments were performed between 11AM and 12 noon in male mice 6-8 weeks of age. Non-stressed mice were habituated to the environment three hours prior to being placed in the light/dark box; three days later, the same mice were transferred to the testing room one night before the experiment for acclimatization, then retro-orbital bleeding or tube restraint was performed three hours before light/dark box test. The light/dark box consisted of two of the same-sized chambers (18x10x13 cm), a dark chamber and an equal size light chamber connected by a small central aperture (3.8×3.8×3.8cm). Urine and feces were removed and the box was cleaned after each trial. Mice were initially placed in the corner of the light chamber facing away from the opening and monitored for 6 minutes after the first entry into the dark section. The latency time for the first passage from the light section to the dark one, transitions between the two compartments, and the amount of time spent in the dark were recorded (

).

 Immunohistochemistry

Mice were euthanized and perfused with PBS or fixative. Brown adipose tissues were immersion-fixed in 10% neutral buffered formalin. Then tissues were trimmed, processed, embedded, and sectioned and stained for IL-6.

 Quantification and Statistical Analysis

Statistical analyses were performed using Prism 8.0 (GraphPad Software, Inc.). For parameters obtained from metabolic cage, the area under a curve was calculated followed by Student’s t test. Student’s t test was used for two groups comparison. More than two groups were compared using one-way analysis of variance (ANOVA) followed by Tukey test. Samples at different time points from multiple groups were analyzed using two-way ANOVA followed by Tukey test. The log-rank Mantel-Cox test was used to compare Kaplan Meier curves. A p value less than 0.05 was considered statistically significant. Data are presented as the mean ± SEM.  p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001

Acknowledgments

We thank members of the Wang, Picciotto, Sinha, and Perry labs for helpful discussions. We are indebted to Dr. Ruslan Medzhitov for his guidance and support. We thank Ali Nasiri and Wanling Zhu for the mouse metabolic flux phenotyping, Dr. Mamula’s lab for sharing equipment, and Dr. Akiko Iwasaki for use of thermoneutral cabinets. We thank Mrs. Krista Wang, Dr. Ruth Franklin, and Dr. Harding Luan for review of the manuscript. Invasive hemodynamic monitoring was performed through the George M. O’Brien Kidney Center at Yale ( NIH P30-DK079310 ). A.W. was supported by the NIH Clinical Investigator Award ( K08AI128745 ). K.I.-W. was supported by a Gruber Fellowship . Metabolic flux analysis performed in the Perry lab was supported by an NIH Pathway to Independence Award ( K99/R00 CA215315 ) to R.J.P. M.R.P. was supported by NIH grants DA050986 , MH077681 , and DA14241 . R.S. was supported by NIH grant R01-DK099039 .

Author Contributions

H.Q. and R.D. contributed equally to this work. H.Q., R.D., and A.W. designed the study, analyzed the data, and wrote the manuscript with input from the other authors. H.Q. and R.D. performed the experiments with assistance from K.I.-W. and C.Z. R.J.P. performed all analyses for flux studies. S.R. in the laboratory of N.W.P. assisted with experiments with gnotobiotic animals. N.F. in the laboratory of R.S. collected all human samples, performed the analyses, and provided input into stress biology. Y.M., in the laboratory of M.R.P. provided assistance with behavioral studies.

Declaration of Interests

The authors declare no competing interests.

Supplemental Information

References

    • Abreu-Vieira G.
    • Hagberg C.E.
    • Spalding K.L.
    • Cannon B.
    • Nedergaard J.
    Adrenergically stimulated blood flow in brown adipose tissue is not dependent on thermogenesis.

    Am. J. Physiol. Endocrinol. Metab. 2015; 308E822-E829

    • Ağaç D.
    • Estrada L.D.
    • Maples R.
    • Hooper L.V.
    • Farrar J.D.
  1. The β2-adrenergic receptor controls inflammation by driving rapid IL-10 secretion.

    Brain Behav. Immun. 2018; 74176-185

    • Ansell E.B.
    • Rando K.
    • Tuit K.
    • Guarnaccia J.
    • Sinha R.
  2. Cumulative adversity and smaller gray matter volume in medial prefrontal, anterior cingulate, and insula regions.

    Biol. Psychiatry. 2012; 7257-64

    • Aune U.L.
    • Ruiz L.
    • Kajimura S.
  3. Isolation and differentiation of stromal vascular cells to beige/brite cells.

    J. Vis. Exp. 2013; 50191

    • Banzet S.
    • Koulmann N.
    • Simler N.
    • Sanchez H.
    • Chapot R.
    • Serrurier B.
    • Peinnequin A.
    • Bigard X.
  4. Control of gluconeogenic genes during intense/prolonged exercise: hormone-independent effect of muscle-derived IL-6 on hepatic tissue and PEPCK mRNA.

    J. Appl. Physiol. (1985). 2009; 1071830-1839

    • Batty G.D.
    • Russ T.C.
    • Stamatakis E.
    • Kivimaki M.
  5. Psychological distress in relation to site specific cancer mortality: pooling of unpublished data from 16 prospective cohort studies.

    BMJ. 2017; 356j108

    • Benrick A.
    • Wallenius V.
    • Asterholm I.W.
  6. Interleukin-6 mediates exercise-induced increase in insulin sensitivity in mice.

    Exp. Physiol. 2012; 971224-1235

    • Bethin K.E.
    • Vogt S.K.
    • Muglia L.J.
  7. Interleukin-6 is an essential, corticotropin-releasing hormone-independent stimulator of the adrenal axis during immune system activation.

    Proc. Natl. Acad. Sci. USA. 2000; 979317-9322

    • Black D.S.
    • Slavich G.M.
  8. Mindfulness meditation and the immune system: a systematic review of randomized controlled trials.

    Ann. N Y Acad. Sci. 2016; 137313-24

    • Boden G.
    • Chen X.
    • Ruiz J.
    • White J.V.
    • Rossetti L.
  9. Mechanisms of fatty acid-induced inhibition of glucose uptake.

    J. Clin. Invest. 1994; 932438-2446

    • Boucher J.
    • Kleinridders A.
    • Kahn C.R.
  10. Insulin receptor signaling in normal and insulin-resistant states.

    Cold Spring Harb. Perspect. Biol. 2014; 6a009191

    • Bourin M.
    • Hascoët M.
  11. The mouse light/dark box test.

    Eur. J. Pharmacol. 2003; 46355-65

    • Carey A.L.
    • Steinberg G.R.
    • Macaulay S.L.
    • Thomas W.G.
    • Holmes A.G.
    • Ramm G.
    • Prelovsek O.
    • Hohnen-Behrens C.
    • Watt M.J.
    • James D.E.
    • et al.
  12. Interleukin-6 increases insulin-stimulated glucose disposal in humans and glucose uptake and fatty acid oxidation in vitro via AMP-activated protein kinase.

    Diabetes. 2006; 552688-2697

    • Castañeda S.
    • Remuzgo-Martínez S.
    • López-Mejías R.
    • Genre F.
    • Calvo-Alén J.
    • Llorente I.
    • Aurrecoechea E.
    • Ortiz A.M.
    • Triguero A.
    • Blanco R.
    • et al.
  13. Rapid beneficial effect of the IL-6 receptor blockade on insulin resistance and insulin sensitivity in non-diabetic patients with rheumatoid arthritis.

    Clin. Exp. Rheumatol. 2019; 37465-473

    • Castell J.V.
    • Gómez-Lechón M.J.
    • David M.
    • Andus T.
    • Geiger T.
    • Trullenque R.
    • Fabra R.
    • Heinrich P.C.
  14. Interleukin-6 is the major regulator of acute phase protein synthesis in adult human hepatocytes.

    FEBS Lett. 1989; 242237-239

    • Cheng Y.
    • Jope R.S.
    • Beurel E.
  15. A pre-conditioning stress accelerates increases in mouse plasma inflammatory cytokines induced by stress.

    BMC Neurosci. 2015; 1631

    • Chowdhury S.
    • Schulz L.
    • Palmisano B.
    • Singh P.
    • Berger J.M.
    • Yadav V.K.
    • Mera P.
    • Ellingsgaard H.
    • Hidalgo J.
    • Brüning J.
    • Karsenty G.
  16. Muscle-derived Interleukin 6 Increases Exercise Capacity by Signaling in Osteoblasts.

    J. Clin. Invest. 2020; 1302888-2902

    • Cohen S.
    • Janicki-Deverts D.
    • Doyle W.J.
    • Miller G.E.
    • Frank E.
    • Rabin B.S.
    • Turner R.B.
  17. Chronic stress, glucocorticoid receptor resistance, inflammation, and disease risk.

    Proc. Natl. Acad. Sci. USA. 2012; 1095995-5999

    • Covarrubias A.J.
    • Horng T.
  18. IL-6 strikes a balance in metabolic inflammation.

    Cell Metab. 2014; 19898-899

    • de Jong J.M.A.
    • Sun W.
    • Pires N.D.
    • Frontini A.
    • Balaz M.
    • Jespersen N.Z.
    • Feizi A.
    • Petrovic K.
    • Fischer A.W.
    • Bokhari M.H.
    • et al.
  19. Human brown adipose tissue is phenocopied by classical brown adipose tissue in physiologically humanized mice.

    Nat. Metab. 2019; 1830-843

    • Depocas F.
    • Foster D.O.
    • Zaror-Behrens G.
    • Lacelle S.
    • Nadeau B.
  20. Recovery of function in sympathetic nerves of interscapular brown adipose tissue of rats treated with 6-hydroxydopamine.

    Can. J. Physiol. Pharmacol. 1984; 621327-1332

    • Eisner M.D.
    • Katz P.P.
    • Lactao G.
    • Iribarren C.
  21. Impact of depressive symptoms on adult asthma outcomes.

    Ann. Allergy Asthma Immunol. 2005; 94566-574

    • Esposito K.
    • Nappo F.
    • Marfella R.
    • Giugliano G.
    • Giugliano F.
    • Ciotola M.
    • Quagliaro L.
    • Ceriello A.
    • Giugliano D.
  22. Inflammatory cytokine concentrations are acutely increased by hyperglycemia in humans: role of oxidative stress.

    Circulation. 2002; 1062067-2072

    • Febbraio M.A.
    • Hiscock N.
    • Sacchetti M.
    • Fischer C.P.
    • Pedersen B.K.
  23. Interleukin-6 is a novel factor mediating glucose homeostasis during skeletal muscle contraction.

    Diabetes. 2004; 531643-1648

    • Felger J.C.
    • Lotrich F.E.
  24. Inflammatory cytokines in depression: neurobiological mechanisms and therapeutic implications.

    Neuroscience. 2013; 246199-229

    • Ferreira A.
    • Marguti I.
    • Bechmann I.
    • Jeney V.
    • Chora A.
    • Palha N.R.
    • Rebelo S.
    • Henri A.
    • Beuzard Y.
    • Soares M.P.
  25. Sickle hemoglobin confers tolerance to Plasmodium infection.

    Cell. 2011; 145398-409

    • Findeisen M.
    • Allen T.L.
    • Henstridge D.C.
    • Kammoun H.
    • Brandon A.E.
    • Baggio L.L.
    • Watt K.I.
    • Pal M.
    • Cron L.
    • Estevez E.
    • et al.
  26. Treatment of type 2 diabetes with the designer cytokine IC7Fc.

    Nature. 2019; 57463-68

    • Frank M.G.
    • Watkins L.R.
    • Maier S.F.
  27. Stress-induced glucocorticoids as a neuroendocrine alarm signal of danger.

    Brain Behav. Immun. 2013; 331-6

    • Ganeshan K.
    • Nikkanen J.
    • Man K.
    • Leong Y.A.
    • Sogawa Y.
    • Maschek J.A.
    • Van Ry T.
    • Chagwedera D.N.
    • Cox J.E.
    • Chawla A.
  28. Energetic Trade-Offs and Hypometabolic States Promote Disease Tolerance.

    Cell. 2019; 177399-413